Incidental Mutation 'R1980:Tyro3'
ID222108
Institutional Source Beutler Lab
Gene Symbol Tyro3
Ensembl Gene ENSMUSG00000027298
Gene NameTYRO3 protein tyrosine kinase 3
SynonymsBrt, Etk-2, Sky, Sky, Dtk, Rse, Tif
MMRRC Submission 039992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1980 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119797733-119818104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119808817 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 335 (D335G)
Ref Sequence ENSEMBL: ENSMUSP00000106410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028763] [ENSMUST00000110783]
Predicted Effect probably benign
Transcript: ENSMUST00000028763
AA Change: D339G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028763
Gene: ENSMUSG00000027298
AA Change: D339G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc2 45 114 1.29e-15 SMART
IG 135 212 1.3e-2 SMART
FN3 215 297 1.5e-5 SMART
FN3 313 393 1.9e0 SMART
transmembrane domain 419 441 N/A INTRINSIC
TyrKc 508 776 1.18e-125 SMART
low complexity region 817 832 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110783
AA Change: D335G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106410
Gene: ENSMUSG00000027298
AA Change: D335G

DomainStartEndE-ValueType
IGc2 41 110 1.29e-15 SMART
IG 131 208 1.3e-2 SMART
FN3 211 293 1.5e-5 SMART
FN3 309 389 1.9e0 SMART
transmembrane domain 415 437 N/A INTRINSIC
TyrKc 504 772 1.18e-125 SMART
low complexity region 813 828 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147761
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
A730017C20Rik T A 18: 59,075,667 M129K probably damaging Het
Acly A C 11: 100,495,876 I620S possibly damaging Het
Acot8 A G 2: 164,795,044 F262S probably damaging Het
Adgb C T 10: 10,433,498 V246I probably benign Het
Akap9 T A 5: 3,972,771 M1200K probably damaging Het
Alg11 T A 8: 22,061,887 F16I possibly damaging Het
Apol7c A G 15: 77,526,044 V234A probably benign Het
Arhgap19 T G 19: 41,788,345 I122L possibly damaging Het
Arhgef37 A G 18: 61,508,696 S201P probably damaging Het
Asgr1 A T 11: 70,054,946 D16V probably damaging Het
Camta2 A T 11: 70,682,482 C227S probably benign Het
Cd22 A T 7: 30,873,233 L317Q probably damaging Het
Cenpf A T 1: 189,653,915 I2056K probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Ciapin1 C T 8: 94,832,533 V43I probably benign Het
Dach1 A G 14: 97,831,341 L601P probably damaging Het
Ddx11 T A 17: 66,148,739 L711Q probably damaging Het
Dsg1a A T 18: 20,338,650 N653I probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Galnt5 T C 2: 58,024,723 probably null Het
Gemin5 A G 11: 58,136,917 L935P probably damaging Het
Gm11273 T G 13: 21,501,124 T99P possibly damaging Het
Gm9507 A T 10: 77,811,685 C53* probably null Het
Irgm2 A G 11: 58,220,076 I198V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 A C 14: 100,149,726 probably null Het
Lpp C T 16: 24,661,701 P73L probably damaging Het
Lrrc34 G A 3: 30,642,741 H127Y probably benign Het
Lyar T C 5: 38,224,709 S12P probably damaging Het
Maml3 A G 3: 52,104,052 I31T unknown Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mysm1 A T 4: 94,952,213 N655K probably benign Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrxn1 A G 17: 91,088,318 W137R probably benign Het
Numb C T 12: 83,797,344 probably null Het
Obsl1 A G 1: 75,505,836 F130S probably damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr91 T G 17: 37,093,403 Q157P probably damaging Het
Pbx4 T C 8: 69,870,126 V294A probably benign Het
Pde4dip A C 3: 97,756,996 L524R possibly damaging Het
Plppr1 G A 4: 49,337,655 A319T probably benign Het
Ppid A T 3: 79,593,618 I32F probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr27 A G 5: 87,843,402 E291G probably benign Het
Psme4 A T 11: 30,832,615 K923N possibly damaging Het
Rab25 T C 3: 88,543,458 T45A probably damaging Het
Rapgef1 C T 2: 29,722,227 P630S probably benign Het
Rasa2 T C 9: 96,570,768 D355G probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rtn4 A T 11: 29,708,634 E929D probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Slk T G 19: 47,611,989 I151S probably damaging Het
Spin1 T A 13: 51,144,470 V175D probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tmem151b G C 17: 45,545,461 P351R possibly damaging Het
Tmod1 A C 4: 46,061,043 Y10S probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm1 T C 7: 64,208,434 Y225H possibly damaging Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Unc79 C A 12: 103,011,279 Y180* probably null Het
Upp1 A T 11: 9,134,872 D197V possibly damaging Het
Vmn1r226 T A 17: 20,688,046 M180K possibly damaging Het
Vtn T A 11: 78,501,898 I434N probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp819 A G 7: 43,616,461 T47A probably benign Het
Zyg11b G A 4: 108,265,930 T280I probably damaging Het
Other mutations in Tyro3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Tyro3 APN 2 119813200 missense probably damaging 1.00
IGL02221:Tyro3 APN 2 119812590 missense probably benign 0.00
IGL02389:Tyro3 APN 2 119804864 splice site probably benign
IGL02442:Tyro3 APN 2 119808868 missense probably benign 0.16
PIT4382001:Tyro3 UTSW 2 119802364 missense probably damaging 1.00
R0078:Tyro3 UTSW 2 119817006 missense probably damaging 1.00
R0087:Tyro3 UTSW 2 119801701 missense probably benign 0.38
R0503:Tyro3 UTSW 2 119803230 splice site probably benign
R0551:Tyro3 UTSW 2 119816904 missense probably damaging 1.00
R1858:Tyro3 UTSW 2 119801695 missense possibly damaging 0.95
R1902:Tyro3 UTSW 2 119801695 missense possibly damaging 0.73
R2294:Tyro3 UTSW 2 119805645 missense probably damaging 0.99
R3877:Tyro3 UTSW 2 119813293 missense probably damaging 0.98
R4651:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4652:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4698:Tyro3 UTSW 2 119803270 missense probably damaging 1.00
R4757:Tyro3 UTSW 2 119810938 missense probably damaging 1.00
R4894:Tyro3 UTSW 2 119802298 missense probably damaging 0.96
R5193:Tyro3 UTSW 2 119810517 missense probably damaging 1.00
R5366:Tyro3 UTSW 2 119804831 missense probably damaging 1.00
R5693:Tyro3 UTSW 2 119810868 missense probably damaging 1.00
R6017:Tyro3 UTSW 2 119816666 missense probably damaging 1.00
R6110:Tyro3 UTSW 2 119812823 missense probably damaging 1.00
R6160:Tyro3 UTSW 2 119803270 missense probably damaging 0.98
R6290:Tyro3 UTSW 2 119816840 missense probably benign
R6293:Tyro3 UTSW 2 119808000 missense possibly damaging 0.89
R6366:Tyro3 UTSW 2 119816675 missense probably damaging 0.96
R6712:Tyro3 UTSW 2 119804854 missense probably null 0.44
R7645:Tyro3 UTSW 2 119816906 missense probably damaging 1.00
Z1088:Tyro3 UTSW 2 119809467 missense probably benign 0.31
Z1177:Tyro3 UTSW 2 119809991 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTAGCAGTTGCAGCTGGGAG -3'
(R):5'- TGCATACAAAGCGGCCACAG -3'

Sequencing Primer
(F):5'- GAGGCCAGCCCTTTCCTCAC -3'
(R):5'- ACAGGGAGTGTGCCTAGC -3'
Posted On2014-08-25