Incidental Mutation 'R5366:Tyro3'
ID429324
Institutional Source Beutler Lab
Gene Symbol Tyro3
Ensembl Gene ENSMUSG00000027298
Gene NameTYRO3 protein tyrosine kinase 3
SynonymsBrt, Etk-2, Sky, Sky, Dtk, Rse, Tif
MMRRC Submission 042944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5366 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119797733-119818104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119804831 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 201 (R201Q)
Ref Sequence ENSEMBL: ENSMUSP00000106410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028763] [ENSMUST00000110783]
Predicted Effect probably damaging
Transcript: ENSMUST00000028763
AA Change: R205Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028763
Gene: ENSMUSG00000027298
AA Change: R205Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc2 45 114 1.29e-15 SMART
IG 135 212 1.3e-2 SMART
FN3 215 297 1.5e-5 SMART
FN3 313 393 1.9e0 SMART
transmembrane domain 419 441 N/A INTRINSIC
TyrKc 508 776 1.18e-125 SMART
low complexity region 817 832 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110783
AA Change: R201Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106410
Gene: ENSMUSG00000027298
AA Change: R201Q

DomainStartEndE-ValueType
IGc2 41 110 1.29e-15 SMART
IG 131 208 1.3e-2 SMART
FN3 211 293 1.5e-5 SMART
FN3 309 389 1.9e0 SMART
transmembrane domain 415 437 N/A INTRINSIC
TyrKc 504 772 1.18e-125 SMART
low complexity region 813 828 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148343
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,242,288 M657K possibly damaging Het
4932431P20Rik A C 7: 29,533,539 noncoding transcript Het
Abcb5 T C 12: 118,867,930 N1229S possibly damaging Het
Adgre1 G A 17: 57,402,817 C158Y probably benign Het
Ahnak T A 19: 9,016,735 S5128T possibly damaging Het
Ankrd36 T A 11: 5,592,841 C322* probably null Het
Ano1 T A 7: 144,654,209 T113S possibly damaging Het
Apeh A T 9: 108,091,806 S321T probably benign Het
Atg4d T A 9: 21,268,652 V273D probably damaging Het
Cacna2d4 A G 6: 119,274,318 D489G probably damaging Het
Cd47 T C 16: 49,896,373 F256L probably damaging Het
Cd84 A T 1: 171,873,305 D211V probably damaging Het
Cfap46 A G 7: 139,650,886 L942P probably damaging Het
Cfh A C 1: 140,136,235 C434W probably damaging Het
Chst2 T C 9: 95,405,465 D276G probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Degs1 C A 1: 182,279,362 D111Y probably benign Het
Dhps T A 8: 85,074,784 D313E probably damaging Het
Dock9 A G 14: 121,578,203 C1645R probably damaging Het
Efcab7 A C 4: 99,904,734 D407A possibly damaging Het
Eif3a G T 19: 60,779,533 T189N probably benign Het
Ep300 T A 15: 81,616,100 L57M probably benign Het
Exoc6b T A 6: 84,890,531 I300L probably benign Het
Fam69c T A 18: 84,730,595 L106Q probably damaging Het
Fzd8 T C 18: 9,213,880 S321P probably damaging Het
Gm9920 T A 15: 55,112,309 probably benign Het
Gucy2c A G 6: 136,720,741 I668T probably damaging Het
Irgc1 C T 7: 24,433,426 probably benign Het
Jsrp1 G T 10: 80,810,196 S143* probably null Het
Kctd4 T C 14: 75,962,819 Y77H probably damaging Het
Klhdc1 T A 12: 69,283,150 I351N probably damaging Het
Klra17 C T 6: 129,874,895 E5K possibly damaging Het
Mapk8 A T 14: 33,390,729 V211E probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrc1 T C 2: 14,321,914 Y1208H probably benign Het
Mrps16 A T 14: 20,391,455 S94T probably benign Het
Muc5ac A G 7: 141,807,550 T1533A probably benign Het
Myh10 A T 11: 68,760,692 D287V probably damaging Het
Obscn T C 11: 59,080,260 T2476A probably damaging Het
Olfm2 T A 9: 20,668,412 T356S probably benign Het
Olfr1313 T C 2: 112,072,478 Y35C possibly damaging Het
P2rx2 T A 5: 110,341,828 N108I probably damaging Het
Pbx4 A T 8: 69,870,170 T309S probably benign Het
Phyhip C A 14: 70,466,855 H171Q probably benign Het
Pou4f3 A G 18: 42,395,754 E254G probably damaging Het
Pxdn C A 12: 30,002,900 H845Q probably damaging Het
Rgcc T C 14: 79,291,683 T111A probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sgsm1 C A 5: 113,251,039 E722D possibly damaging Het
Soat1 A T 1: 156,444,611 D101E probably benign Het
Spag5 T A 11: 78,320,326 probably null Het
Spata31 A T 13: 64,920,459 E140D probably damaging Het
Srrm2 T A 17: 23,818,704 S1537T probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tbc1d4 G T 14: 101,607,976 T162K possibly damaging Het
Tmem163 A C 1: 127,500,305 probably benign Het
Tmem43 T C 6: 91,478,258 V72A probably benign Het
Tmprss11c G A 5: 86,282,134 T24I possibly damaging Het
Trerf1 A T 17: 47,315,190 noncoding transcript Het
Trim44 A G 2: 102,400,131 L185P probably damaging Het
Tspyl1 A G 10: 34,282,345 D22G possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn2a T A 12: 4,880,741 K206N probably benign Het
Usp17lb G T 7: 104,840,408 H436Q possibly damaging Het
Vps9d1 A G 8: 123,245,114 I584T possibly damaging Het
Vrk1 T A 12: 106,055,819 M131K possibly damaging Het
Zfp827 A T 8: 79,185,704 K986N possibly damaging Het
Zswim4 A G 8: 84,212,790 M821T probably benign Het
Other mutations in Tyro3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Tyro3 APN 2 119813200 missense probably damaging 1.00
IGL02221:Tyro3 APN 2 119812590 missense probably benign 0.00
IGL02389:Tyro3 APN 2 119804864 splice site probably benign
IGL02442:Tyro3 APN 2 119808868 missense probably benign 0.16
PIT4382001:Tyro3 UTSW 2 119802364 missense probably damaging 1.00
R0078:Tyro3 UTSW 2 119817006 missense probably damaging 1.00
R0087:Tyro3 UTSW 2 119801701 missense probably benign 0.38
R0503:Tyro3 UTSW 2 119803230 splice site probably benign
R0551:Tyro3 UTSW 2 119816904 missense probably damaging 1.00
R1858:Tyro3 UTSW 2 119801695 missense possibly damaging 0.95
R1902:Tyro3 UTSW 2 119801695 missense possibly damaging 0.73
R1980:Tyro3 UTSW 2 119808817 missense probably benign
R2294:Tyro3 UTSW 2 119805645 missense probably damaging 0.99
R3877:Tyro3 UTSW 2 119813293 missense probably damaging 0.98
R4651:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4652:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4698:Tyro3 UTSW 2 119803270 missense probably damaging 1.00
R4757:Tyro3 UTSW 2 119810938 missense probably damaging 1.00
R4894:Tyro3 UTSW 2 119802298 missense probably damaging 0.96
R5193:Tyro3 UTSW 2 119810517 missense probably damaging 1.00
R5693:Tyro3 UTSW 2 119810868 missense probably damaging 1.00
R6017:Tyro3 UTSW 2 119816666 missense probably damaging 1.00
R6110:Tyro3 UTSW 2 119812823 missense probably damaging 1.00
R6160:Tyro3 UTSW 2 119803270 missense probably damaging 0.98
R6290:Tyro3 UTSW 2 119816840 missense probably benign
R6293:Tyro3 UTSW 2 119808000 missense possibly damaging 0.89
R6366:Tyro3 UTSW 2 119816675 missense probably damaging 0.96
R6712:Tyro3 UTSW 2 119804854 missense probably null 0.44
R7645:Tyro3 UTSW 2 119816906 missense probably damaging 1.00
Z1088:Tyro3 UTSW 2 119809467 missense probably benign 0.31
Z1177:Tyro3 UTSW 2 119809991 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTAGACTGCAAAGTCCTCGCTC -3'
(R):5'- TGCCAATAACTCCTCACCTG -3'

Sequencing Primer
(F):5'- AACCCGATCCTTTGGCTAGAG -3'
(R):5'- TAACTCCTCACCTGCAGATCC -3'
Posted On2016-09-06