Incidental Mutation 'R2016:Sema6c'
List |< first << previous [record 69 of 83] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
SynonymsSema Y, Semay
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosomal Location95160457-95174024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95171234 bp
Amino Acid Change Isoleucine to Valine at position 549 (I549V)
Ref Sequence ENSEMBL: ENSMUSP00000144039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000142449] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709]
Predicted Effect probably benign
Transcript: ENSMUST00000090821
AA Change: I549V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: I549V

signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090823
AA Change: I549V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: I549V

signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107217
AA Change: I509V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: I509V

signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168321
AA Change: I549V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: I549V

signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202315
AA Change: I549V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: I549V

signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95172398 missense probably damaging 1.00
IGL01631:Sema6c APN 3 95170403 missense probably benign 0.10
IGL01799:Sema6c APN 3 95170831 missense probably damaging 1.00
IGL02237:Sema6c APN 3 95170119 missense probably damaging 1.00
IGL02852:Sema6c APN 3 95169984 splice site probably benign
IGL02874:Sema6c APN 3 95170377 missense probably damaging 1.00
IGL03003:Sema6c APN 3 95169614 missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95170090 missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95168691 missense probably damaging 1.00
R0582:Sema6c UTSW 3 95169197 missense probably damaging 1.00
R0590:Sema6c UTSW 3 95172623 missense probably damaging 1.00
R0685:Sema6c UTSW 3 95172710 missense possibly damaging 0.46
R1056:Sema6c UTSW 3 95171216 missense probably benign 0.15
R1721:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1867:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1868:Sema6c UTSW 3 95170813 missense probably damaging 0.99
R2343:Sema6c UTSW 3 95167083 missense probably damaging 1.00
R2898:Sema6c UTSW 3 95172818 missense probably damaging 1.00
R4095:Sema6c UTSW 3 95173194 missense probably benign 0.03
R4999:Sema6c UTSW 3 95168363 missense probably damaging 1.00
R5263:Sema6c UTSW 3 95173152 missense probably benign 0.02
R6914:Sema6c UTSW 3 95173208 missense probably benign 0.00
R6942:Sema6c UTSW 3 95173208 missense probably benign 0.00
R7104:Sema6c UTSW 3 95168845 missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95167060 missense probably benign 0.20
R7724:Sema6c UTSW 3 95173199 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25