Incidental Mutation 'R2016:Flnc'
ID223004
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 29443797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect probably null
Transcript: ENSMUST00000065090
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090474
SMART Domains Protein: ENSMUSP00000087960
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2726 4.32e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101617
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148404
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7697:Flnc UTSW 6 29456517 missense probably damaging 0.98
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGATACCAGCTCTTTCC -3'
(R):5'- CAATCTTGGCTTGTGAGGGC -3'

Sequencing Primer
(F):5'- GCACTGATACCAGCTCTTTCCTTTAC -3'
(R):5'- CCTCGATGGAGAAGCCTGGAG -3'
Posted On2014-08-25