Incidental Mutation 'R2016:Slc5a4a'
ID 223046
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
MMRRC Submission 040025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R2016 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 75983285-76025099 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 75989414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 106 (F106V)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
AA Change: F106V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: F106V

transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 164,920,946 (GRCm39) D29G unknown Het
Abca13 A T 11: 9,240,619 (GRCm39) L827F probably damaging Het
Abca8a A G 11: 109,961,213 (GRCm39) F570L probably damaging Het
Adck1 T A 12: 88,427,862 (GRCm39) I493N probably damaging Het
Adra2c T C 5: 35,437,656 (GRCm39) C143R probably damaging Het
Afg2a T C 3: 37,632,911 (GRCm39) V839A possibly damaging Het
Akap13 C T 7: 75,354,279 (GRCm39) T1800M probably damaging Het
Angpt2 T C 8: 18,755,747 (GRCm39) N240S probably damaging Het
Apob G A 12: 8,057,751 (GRCm39) D2078N possibly damaging Het
Atp8b1 T C 18: 64,673,405 (GRCm39) N989S probably damaging Het
B3gnt2 T C 11: 22,786,621 (GRCm39) D189G probably damaging Het
Bcam G A 7: 19,494,274 (GRCm39) T374M probably benign Het
Blm T C 7: 80,155,674 (GRCm39) D335G probably benign Het
Cbfa2t2 T C 2: 154,359,727 (GRCm39) L264P probably damaging Het
Col4a2 T C 8: 11,495,086 (GRCm39) F1515L probably benign Het
Csf2ra T G 19: 61,215,331 (GRCm39) M95L probably benign Het
Cyp2c70 T A 19: 40,152,856 (GRCm39) T300S possibly damaging Het
Cyp4f15 A T 17: 32,921,133 (GRCm39) H440L probably damaging Het
Dcaf1 T A 9: 106,716,287 (GRCm39) D360E probably benign Het
Ddr2 T C 1: 169,812,537 (GRCm39) M652V probably damaging Het
Dnah2 T A 11: 69,327,896 (GRCm39) I3370F probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Efemp1 G T 11: 28,871,613 (GRCm39) R376L probably damaging Het
Efl1 A C 7: 82,402,917 (GRCm39) D673A probably damaging Het
Eid1 A G 2: 125,515,121 (GRCm39) M4V probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Emilin3 G A 2: 160,751,530 (GRCm39) R170C possibly damaging Het
Erap1 T C 13: 74,812,270 (GRCm39) W362R probably damaging Het
Fam234a A G 17: 26,437,290 (GRCm39) F91L probably benign Het
Flnc G A 6: 29,443,796 (GRCm39) probably null Het
Fsip2 A G 2: 82,813,076 (GRCm39) K3132E possibly damaging Het
Garin5b A T 7: 4,762,397 (GRCm39) I244N probably damaging Het
Gnl3 A G 14: 30,738,326 (GRCm39) probably null Het
Has1 A T 17: 18,068,532 (GRCm39) I274N probably damaging Het
Ift70a1 A G 2: 75,811,801 (GRCm39) L94P probably benign Het
Itsn1 T C 16: 91,702,389 (GRCm39) probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kif13a T C 13: 46,964,275 (GRCm39) D475G probably benign Het
Klhl20 A T 1: 160,930,608 (GRCm39) M298K probably damaging Het
Kynu G T 2: 43,494,289 (GRCm39) G241* probably null Het
Lrif1 G T 3: 106,639,522 (GRCm39) L202F possibly damaging Het
Lrp5 T C 19: 3,660,056 (GRCm39) K1003E probably benign Het
Mamdc2 T C 19: 23,311,393 (GRCm39) D487G probably damaging Het
Mapk8ip1 A G 2: 92,221,379 (GRCm39) probably null Het
Mettl25 T A 10: 105,633,167 (GRCm39) E425D probably benign Het
Midn G T 10: 79,985,949 (GRCm39) R13L possibly damaging Het
Mtmr9 T C 14: 63,777,713 (GRCm39) Y136C possibly damaging Het
Mylk G A 16: 34,817,187 (GRCm39) V61M probably damaging Het
Nalcn T C 14: 123,831,993 (GRCm39) probably null Het
Nle1 G T 11: 82,796,373 (GRCm39) P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 (GRCm39) C595Y probably damaging Het
Or10d4 A G 9: 39,580,851 (GRCm39) Y166C probably damaging Het
Or4g7 G T 2: 111,309,532 (GRCm39) M134I probably benign Het
Or4l15 A G 14: 50,197,959 (GRCm39) I190T probably benign Het
Or5w1b C T 2: 87,476,396 (GRCm39) V24M probably benign Het
Or8b1 A T 9: 38,399,309 (GRCm39) probably null Het
Pds5a T A 5: 65,805,350 (GRCm39) probably null Het
Pitpnm1 T C 19: 4,161,873 (GRCm39) V955A probably benign Het
Plcb1 T A 2: 135,204,340 (GRCm39) I898N possibly damaging Het
Plcl2 G A 17: 50,913,722 (GRCm39) V244M probably damaging Het
Plk1 A G 7: 121,761,663 (GRCm39) K257R probably damaging Het
Prkcg A T 7: 3,372,066 (GRCm39) T460S probably damaging Het
Prl7d1 G A 13: 27,894,156 (GRCm39) H138Y probably damaging Het
Prss35 A G 9: 86,637,565 (GRCm39) S112G probably benign Het
Ptprj C T 2: 90,294,958 (GRCm39) V417M probably damaging Het
Pwwp2b A T 7: 138,836,067 (GRCm39) I503F possibly damaging Het
Rasgrp2 T C 19: 6,463,195 (GRCm39) V498A probably benign Het
Sall1 A G 8: 89,755,037 (GRCm39) V1314A probably benign Het
Sema6c A G 3: 95,078,545 (GRCm39) I549V probably benign Het
Slc17a1 A G 13: 24,062,522 (GRCm39) S230G probably benign Het
Stat6 T C 10: 127,486,665 (GRCm39) L147P probably damaging Het
Taar7d T A 10: 23,903,642 (GRCm39) S175T probably benign Het
Tasor2 A T 13: 3,626,770 (GRCm39) I1060K probably benign Het
Tmem132b A G 5: 125,700,080 (GRCm39) Q206R probably benign Het
Tmem229a T C 6: 24,955,061 (GRCm39) D231G probably benign Het
Trim66 A G 7: 109,071,439 (GRCm39) probably null Het
Ttll9 A T 2: 152,844,214 (GRCm39) E374V probably damaging Het
Vmn2r69 A T 7: 85,056,493 (GRCm39) D548E probably damaging Het
Zcchc2 T A 1: 105,931,851 (GRCm39) probably null Het
Zfp282 T A 6: 47,874,721 (GRCm39) probably null Het
Zfp352 A G 4: 90,113,408 (GRCm39) E516G probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 75,999,567 (GRCm39) missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76,017,508 (GRCm39) missense probably benign 0.00
IGL02629:Slc5a4a APN 10 75,983,413 (GRCm39) missense unknown
IGL02976:Slc5a4a APN 10 76,006,527 (GRCm39) missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 75,986,346 (GRCm39) missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 75,986,386 (GRCm39) missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76,014,031 (GRCm39) missense probably null 0.00
R0244:Slc5a4a UTSW 10 76,024,986 (GRCm39) missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76,018,556 (GRCm39) missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76,012,368 (GRCm39) missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76,013,995 (GRCm39) missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76,022,362 (GRCm39) missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76,025,103 (GRCm39) splice site probably null
R1857:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1942:Slc5a4a UTSW 10 75,983,422 (GRCm39) missense unknown
R2316:Slc5a4a UTSW 10 76,013,915 (GRCm39) splice site probably null
R3420:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76,024,983 (GRCm39) missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76,017,489 (GRCm39) missense probably benign 0.42
R4523:Slc5a4a UTSW 10 75,984,196 (GRCm39) missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4538:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4755:Slc5a4a UTSW 10 76,022,398 (GRCm39) missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76,014,065 (GRCm39) missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 75,983,428 (GRCm39) missense unknown
R5254:Slc5a4a UTSW 10 76,018,572 (GRCm39) nonsense probably null
R6083:Slc5a4a UTSW 10 75,983,431 (GRCm39) missense unknown
R6331:Slc5a4a UTSW 10 76,014,034 (GRCm39) missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 75,983,501 (GRCm39) critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 75,983,384 (GRCm39) missense unknown
R8785:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76,006,617 (GRCm39) missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76,022,369 (GRCm39) missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76,002,546 (GRCm39) missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76,022,396 (GRCm39) missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76,002,608 (GRCm39) missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76,018,681 (GRCm39) nonsense probably null
Z1177:Slc5a4a UTSW 10 76,002,578 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25