Incidental Mutation 'R2054:Tead4'
ID226517
Institutional Source Beutler Lab
Gene Symbol Tead4
Ensembl Gene ENSMUSG00000030353
Gene NameTEA domain family member 4
SynonymsTEF-3, Etfr2, Tefr, Tef3, Tcf13r1, TEAD-4, ETFR-2a, Tefr1a, Rtef1
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128224288-128300823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128270962 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 37 (S37R)
Ref Sequence ENSEMBL: ENSMUSP00000118083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006311] [ENSMUST00000112157] [ENSMUST00000130454] [ENSMUST00000133118] [ENSMUST00000143004]
Predicted Effect probably damaging
Transcript: ENSMUST00000006311
AA Change: S37R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006311
Gene: ENSMUSG00000030353
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
low complexity region 121 130 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
PDB:4LN0|B 209 427 1e-164 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000112157
AA Change: S37R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107784
Gene: ENSMUSG00000030353
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
Pfam:TEA 111 376 2.2e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130454
AA Change: S37R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118083
Gene: ENSMUSG00000030353
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
TEA 27 98 2.13e-48 SMART
Pfam:TEA 111 376 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133118
AA Change: S37R

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120941
Gene: ENSMUSG00000030353
AA Change: S37R

DomainStartEndE-ValueType
Pfam:TEA 2 55 1.1e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143004
AA Change: S37R
Meta Mutation Damage Score 0.7797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. This factor may play a role in the embryonic development of skeletal muscle. Alternatively spliced transcripts encoding distinct isoforms, which are translated through the use of a non-AUG (AUU) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die prior to somitogenesis, lack trophoblast stem cells and develop abnormally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Tead4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0234:Tead4 UTSW 6 128243402 missense probably damaging 1.00
R0234:Tead4 UTSW 6 128243402 missense probably damaging 1.00
R2865:Tead4 UTSW 6 128248099 splice site probably null
R4959:Tead4 UTSW 6 128270987 missense probably damaging 1.00
R4973:Tead4 UTSW 6 128270987 missense probably damaging 1.00
R5023:Tead4 UTSW 6 128294171 intron probably benign
R5051:Tead4 UTSW 6 128294299 intron probably benign
R6785:Tead4 UTSW 6 128242481 nonsense probably null
R7215:Tead4 UTSW 6 128228678 missense probably damaging 1.00
Z1088:Tead4 UTSW 6 128270904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCCCAAGGTTACTGTG -3'
(R):5'- ACTGGCCTGTACTACTTGGG -3'

Sequencing Primer
(F):5'- TGTCCACTCCTGCTGAACTACAAG -3'
(R):5'- GCAGTGTGCACCATTCTTACTGTG -3'
Posted On2014-09-17