Mutagenetix > Incidental Mutation

Incidental Mutation 'R2054:Trpm1'

226521

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

040059-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64240555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 853 (M853V)

Ref Sequence

ENSEMBL: ENSMUSP00000146140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: M969V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: M969V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000107525
AA Change: M969V

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: M969V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: M853V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: M969V

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.2633

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,837,736	C94S	possibly damaging	Het
4932438A13Rik	A	G	3: 36,947,853	T1316A	probably benign	Het
4933417A18Rik	T	A	13: 34,924,591	Y19N	probably damaging	Het
9330182L06Rik	C	A	5: 9,463,030	T1008K	possibly damaging	Het
A930011G23Rik	T	C	5: 99,228,055	Y432C	probably benign	Het
Abtb2	A	G	2: 103,705,117	D543G	probably benign	Het
Adam9	A	T	8: 24,991,294	V318E	probably damaging	Het
Aim2	T	C	1: 173,463,982	F318L	probably damaging	Het
Apob	A	T	12: 8,013,134	D3872V	probably damaging	Het
Atat1	T	A	17: 35,901,369	R323W	probably null	Het
Atp2b4	T	C	1: 133,715,169	D1066G	probably benign	Het
Caskin2	T	C	11: 115,806,301		probably benign	Het
Ccdc54	T	A	16: 50,590,624	N93I	probably damaging	Het
Ccnd1	A	C	7: 144,937,391	D159E	possibly damaging	Het
Cnot1	A	C	8: 95,739,841	S1589R	possibly damaging	Het
Copa	T	A	1: 172,118,957	Y980*	probably null	Het
Defb19	A	G	2: 152,576,170	I82T	possibly damaging	Het
Fiz1	G	A	7: 5,008,236	R428C	probably damaging	Het
Fnip2	A	T	3: 79,572,465		probably benign	Het
Gabrb3	G	A	7: 57,824,493	G408S	probably benign	Het
Gif	G	A	19: 11,759,006	V314I	probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Hao1	C	T	2: 134,498,258		silent	Het
Hecw1	T	A	13: 14,297,413	M557L	probably damaging	Het
Itch	A	T	2: 155,210,576	I699F	probably damaging	Het
Kmt2a	T	C	9: 44,823,374		probably benign	Het
Leng8	T	G	7: 4,144,290	Y562*	probably null	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrp1b	A	T	2: 40,697,482	N151K	unknown	Het
Lrrc71	T	C	3: 87,742,673	E316G	probably damaging	Het
Mgat5	A	G	1: 127,397,607	N404D	probably damaging	Het
Mrps26	C	A	2: 130,564,167	T100K	probably benign	Het
Mtor	A	G	4: 148,462,852	T431A	probably benign	Het
Mtor	T	A	4: 148,466,025	C713S	probably benign	Het
Mug2	A	G	6: 122,077,492	K1077E	probably damaging	Het
Nbas	A	G	12: 13,474,206	T1688A	probably benign	Het
Nek2	T	C	1: 191,821,652	S3P	possibly damaging	Het
Nell2	T	C	15: 95,435,109	T190A	probably benign	Het
Npr2	A	T	4: 43,646,560	N636I	probably damaging	Het
Orc3	A	T	4: 34,584,846	I453K	probably damaging	Het
Pcnx	A	G	12: 81,933,674	H865R	probably benign	Het
Pex1	T	C	5: 3,603,341	V80A	possibly damaging	Het
Phka2	T	A	X: 160,554,327	D424E	probably damaging	Het
Pkd1	C	T	17: 24,574,796	T1819I	probably benign	Het
Poglut1	T	C	16: 38,534,807	D219G	probably damaging	Het
Ppargc1a	T	C	5: 51,473,788	I500V	possibly damaging	Het
Pygm	C	G	19: 6,388,155	N163K	probably benign	Het
Qrich1	T	A	9: 108,559,270	N722K	possibly damaging	Het
Reep6	T	A	10: 80,330,322	C104*	probably null	Het
Rfx8	A	G	1: 39,685,559	V214A	possibly damaging	Het
Sis	G	A	3: 72,913,237	T1398I	probably benign	Het
Skint5	A	G	4: 113,819,163		probably null	Het
Slc7a14	A	G	3: 31,237,362		probably benign	Het
Smc2	T	A	4: 52,462,948	M646K	probably benign	Het
Snx29	A	G	16: 11,631,492	N165S	probably damaging	Het
Supt6	T	A	11: 78,224,361		probably benign	Het
Tead4	G	T	6: 128,270,962	S37R	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tff2	T	C	17: 31,143,225	K40E	probably benign	Het
Traip	C	T	9: 107,962,919	T265M	probably benign	Het
Trim47	T	C	11: 116,108,283	T256A	probably benign	Het
Tti1	G	T	2: 158,007,445	Q625K	possibly damaging	Het
Ube2n	A	G	10: 95,541,266	N31S	probably damaging	Het
Vmn2r17	T	C	5: 109,452,486	M550T	probably damaging	Het
Zfp512	T	A	5: 31,465,449	N31K	probably benign	Het
Zfp64	A	G	2: 168,925,808	V628A	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TAGGATCCTCTCAGCTTACTGC -3'
(R):5'- TGTTAAGCCAGCTGCAAAGG -3'

Sequencing Primer
(F):5'- CTCTTTGGGGTTTACTTGTAGATCC -3'
(R):5'- ACACCCTAGCTTGGTTTGG -3'

Posted On

2014-09-17