Mutagenetix > Incidental Mutations

Incidental Mutation 'R2054:Slc7a14'

226497

Institutional Source

Beutler Lab

Gene Symbol

Slc7a14

Ensembl Gene

ENSMUSG00000069072

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Synonyms

MMRRC Submission

040059-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R2054 (G1)

Quality Score

190

Status

Validated

Chromosome

Chromosomal Location

31202858-31310378 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 31237362 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]

Predicted Effect

probably benign
Transcript: ENSMUST00000091259

SMART Domains

Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	443	2.1e-44	PFAM
Pfam:AA_permease	57	436	7.2e-38	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	677	9.2e-21	PFAM
low complexity region	737	757	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108245

SMART Domains

Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	445	2.5e-46	PFAM
Pfam:AA_permease	57	437	6.9e-41	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	668	1.4e-17	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	A	T	11: 99,837,736	C94S	possibly damaging	Het
4932438A13Rik	A	G	3: 36,947,853	T1316A	probably benign	Het
4933417A18Rik	T	A	13: 34,924,591	Y19N	probably damaging	Het
9330182L06Rik	C	A	5: 9,463,030	T1008K	possibly damaging	Het
A930011G23Rik	T	C	5: 99,228,055	Y432C	probably benign	Het
Abtb2	A	G	2: 103,705,117	D543G	probably benign	Het
Adam9	A	T	8: 24,991,294	V318E	probably damaging	Het
Aim2	T	C	1: 173,463,982	F318L	probably damaging	Het
Apob	A	T	12: 8,013,134	D3872V	probably damaging	Het
Atat1	T	A	17: 35,901,369	R323W	probably null	Het
Atp2b4	T	C	1: 133,715,169	D1066G	probably benign	Het
Caskin2	T	C	11: 115,806,301		probably benign	Het
Ccdc54	T	A	16: 50,590,624	N93I	probably damaging	Het
Ccnd1	A	C	7: 144,937,391	D159E	possibly damaging	Het
Cnot1	A	C	8: 95,739,841	S1589R	possibly damaging	Het
Copa	T	A	1: 172,118,957	Y980*	probably null	Het
Defb19	A	G	2: 152,576,170	I82T	possibly damaging	Het
Fiz1	G	A	7: 5,008,236	R428C	probably damaging	Het
Fnip2	A	T	3: 79,572,465		probably benign	Het
Gabrb3	G	A	7: 57,824,493	G408S	probably benign	Het
Gif	G	A	19: 11,759,006	V314I	probably benign	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Hao1	C	T	2: 134,498,258		silent	Het
Hecw1	T	A	13: 14,297,413	M557L	probably damaging	Het
Itch	A	T	2: 155,210,576	I699F	probably damaging	Het
Kmt2a	T	C	9: 44,823,374		probably benign	Het
Leng8	T	G	7: 4,144,290	Y562*	probably null	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrp1b	A	T	2: 40,697,482	N151K	unknown	Het
Lrrc71	T	C	3: 87,742,673	E316G	probably damaging	Het
Mgat5	A	G	1: 127,397,607	N404D	probably damaging	Het
Mrps26	C	A	2: 130,564,167	T100K	probably benign	Het
Mtor	A	G	4: 148,462,852	T431A	probably benign	Het
Mtor	T	A	4: 148,466,025	C713S	probably benign	Het
Mug2	A	G	6: 122,077,492	K1077E	probably damaging	Het
Nbas	A	G	12: 13,474,206	T1688A	probably benign	Het
Nek2	T	C	1: 191,821,652	S3P	possibly damaging	Het
Nell2	T	C	15: 95,435,109	T190A	probably benign	Het
Npr2	A	T	4: 43,646,560	N636I	probably damaging	Het
Orc3	A	T	4: 34,584,846	I453K	probably damaging	Het
Pcnx	A	G	12: 81,933,674	H865R	probably benign	Het
Pex1	T	C	5: 3,603,341	V80A	possibly damaging	Het
Phka2	T	A	X: 160,554,327	D424E	probably damaging	Het
Pkd1	C	T	17: 24,574,796	T1819I	probably benign	Het
Poglut1	T	C	16: 38,534,807	D219G	probably damaging	Het
Ppargc1a	T	C	5: 51,473,788	I500V	possibly damaging	Het
Pygm	C	G	19: 6,388,155	N163K	probably benign	Het
Qrich1	T	A	9: 108,559,270	N722K	possibly damaging	Het
Reep6	T	A	10: 80,330,322	C104*	probably null	Het
Rfx8	A	G	1: 39,685,559	V214A	possibly damaging	Het
Sis	G	A	3: 72,913,237	T1398I	probably benign	Het
Skint5	A	G	4: 113,819,163		probably null	Het
Smc2	T	A	4: 52,462,948	M646K	probably benign	Het
Snx29	A	G	16: 11,631,492	N165S	probably damaging	Het
Supt6	T	A	11: 78,224,361		probably benign	Het
Tead4	G	T	6: 128,270,962	S37R	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tff2	T	C	17: 31,143,225	K40E	probably benign	Het
Traip	C	T	9: 107,962,919	T265M	probably benign	Het
Trim47	T	C	11: 116,108,283	T256A	probably benign	Het
Trpm1	A	G	7: 64,240,555	M853V	possibly damaging	Het
Tti1	G	T	2: 158,007,445	Q625K	possibly damaging	Het
Ube2n	A	G	10: 95,541,266	N31S	probably damaging	Het
Vmn2r17	T	C	5: 109,452,486	M550T	probably damaging	Het
Zfp512	T	A	5: 31,465,449	N31K	probably benign	Het
Zfp64	A	G	2: 168,925,808	V628A	probably damaging	Het

Other mutations in Slc7a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02631:Slc7a14	APN	3	31238678	missense	probably damaging	1.00
IGL02713:Slc7a14	APN	3	31257763	missense	probably damaging	0.96
IGL03341:Slc7a14	APN	3	31238770	missense	probably damaging	1.00
IGL03350:Slc7a14	APN	3	31237409	missense	probably benign	0.35
IGL03379:Slc7a14	APN	3	31223515	missense	probably damaging	1.00
R0064:Slc7a14	UTSW	3	31227060	missense	probably damaging	1.00
R1549:Slc7a14	UTSW	3	31224118	missense	possibly damaging	0.94
R1591:Slc7a14	UTSW	3	31237449	missense	probably damaging	1.00
R2057:Slc7a14	UTSW	3	31237496	missense	probably damaging	1.00
R2442:Slc7a14	UTSW	3	31230320	missense	probably damaging	1.00
R2504:Slc7a14	UTSW	3	31237501	missense	possibly damaging	0.85
R3848:Slc7a14	UTSW	3	31237474	missense	probably damaging	1.00
R4653:Slc7a14	UTSW	3	31257682	missense	probably damaging	1.00
R4702:Slc7a14	UTSW	3	31230398	missense	probably damaging	1.00
R5043:Slc7a14	UTSW	3	31237466	missense	probably damaging	1.00
R5187:Slc7a14	UTSW	3	31237365	splice site	probably null
R5345:Slc7a14	UTSW	3	31223857	missense	probably damaging	0.99
R5393:Slc7a14	UTSW	3	31257770	missense	probably damaging	1.00
R5421:Slc7a14	UTSW	3	31224197	missense	probably damaging	1.00
R5736:Slc7a14	UTSW	3	31223910	missense	probably benign	0.00
R5771:Slc7a14	UTSW	3	31238707	missense	probably damaging	1.00
R5896:Slc7a14	UTSW	3	31257570	missense	probably damaging	1.00
R5996:Slc7a14	UTSW	3	31209236	missense	probably benign
R6020:Slc7a14	UTSW	3	31224112	missense	probably benign
R6107:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R6140:Slc7a14	UTSW	3	31237548	missense	probably benign
R6491:Slc7a14	UTSW	3	31223944	missense	probably damaging	1.00
R6846:Slc7a14	UTSW	3	31224223	missense	probably damaging	1.00
R6990:Slc7a14	UTSW	3	31223579	missense	possibly damaging	0.90
R7184:Slc7a14	UTSW	3	31227063	missense	probably damaging	0.98
R7271:Slc7a14	UTSW	3	31224235	missense	probably damaging	1.00
R7282:Slc7a14	UTSW	3	31227153	missense	possibly damaging	0.67
R7331:Slc7a14	UTSW	3	31257731	missense	probably benign	0.00
R8227:Slc7a14	UTSW	3	31209212	missense	probably benign	0.00
R8238:Slc7a14	UTSW	3	31227151	missense	probably benign	0.01
R8524:Slc7a14	UTSW	3	31224133	missense	possibly damaging	0.70
R8843:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
Z1088:Slc7a14	UTSW	3	31223999	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGCAGAAGTGAGCTGTTCC -3'
(R):5'- ACCATCATTGTGGCTCTGGG -3'

Sequencing Primer
(F):5'- GAAGTGAGCTGTTCCTACACAGTC -3'
(R):5'- CATTGTGGCTCTGGGAGTGAAAAAC -3'

Posted On

2014-09-17