Incidental Mutation 'R2054:Slc7a14'
ID226497
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 040059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R2054 (G1)
Quality Score190
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 31237362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably benign
Transcript: ENSMUST00000091259
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hao1 C T 2: 134,498,258 silent Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCAGAAGTGAGCTGTTCC -3'
(R):5'- ACCATCATTGTGGCTCTGGG -3'

Sequencing Primer
(F):5'- GAAGTGAGCTGTTCCTACACAGTC -3'
(R):5'- CATTGTGGCTCTGGGAGTGAAAAAC -3'
Posted On2014-09-17