Mutagenetix > Incidental Mutations

Incidental Mutation 'R2129:Ryr3'

227803

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

040132-MU

Accession Numbers

Genbank: NM_177652.2

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R2129 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 112678370 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]

Predicted Effect

probably benign
Transcript: ENSMUST00000080673

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091818

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134358

Predicted Effect

probably benign
Transcript: ENSMUST00000208151

Predicted Effect

probably benign
Transcript: ENSMUST00000208290

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Abhd14a	A	T	9: 106,440,865	L125Q	probably null	Het
Abhd17b	T	A	19: 21,681,049		probably null	Het
Abo	G	A	2: 26,846,574	T61I	probably benign	Het
Adamts15	T	C	9: 30,904,503	T686A	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Anxa2	A	T	9: 69,476,128	Y75F	possibly damaging	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
BC055324	T	C	1: 163,966,457	Y518C	probably damaging	Het
Bri3bp	T	A	5: 125,451,671	L48*	probably null	Het
Car7	T	A	8: 104,548,973	C185S	possibly damaging	Het
Casp8ap2	T	C	4: 32,640,142	Y399H	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chst10	A	G	1: 38,865,695	Y203H	probably benign	Het
Clca1	T	C	3: 145,016,765	D282G	probably damaging	Het
Coq3	T	G	4: 21,900,342	S190A	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Cygb	A	G	11: 116,649,842	L106P	probably damaging	Het
Dab2	G	T	15: 6,336,383	E87*	probably null	Het
Dcst1	T	A	3: 89,357,545	I299F	probably damaging	Het
Dennd4a	T	G	9: 64,905,974		probably null	Het
Depdc7	A	G	2: 104,728,173	S168P	probably benign	Het
Dicer1	G	A	12: 104,722,031	T429I	probably damaging	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Dock2	T	C	11: 34,727,415	M125V	probably damaging	Het
Dync2h1	A	G	9: 7,175,289	S107P	possibly damaging	Het
Emb	T	C	13: 117,267,546	V278A	probably damaging	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Galm	T	C	17: 80,183,218	I268T	probably benign	Het
Gm5581	A	C	6: 131,168,284		noncoding transcript	Het
Gpr6	G	A	10: 41,071,172	S138L	possibly damaging	Het
Hesx1	C	A	14: 27,000,845	H42Q	possibly damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Kctd19	T	C	8: 105,385,172	T31A	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Krtap19-3	T	C	16: 88,877,975		probably benign	Het
Lin28a	T	A	4: 134,018,154	I43F	probably benign	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	A	G	4: 123,368,815		probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,330,715	L425P	probably damaging	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Mybpc1	T	G	10: 88,551,452	T466P	probably damaging	Het
Myo10	T	C	15: 25,781,799	Y1127H	probably benign	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Myo9b	T	C	8: 71,333,699	Y670H	probably damaging	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Neurod2	G	T	11: 98,327,588	A250E	possibly damaging	Het
Nipsnap1	C	A	11: 4,888,932	N119K	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Olfr330	T	C	11: 58,529,611	D125G	probably damaging	Het
Olfr479	T	A	7: 108,055,904	N307K	probably benign	Het
Olfr748	A	G	14: 50,710,636	Y102C	probably damaging	Het
Pald1	A	G	10: 61,348,306		probably null	Het
Palld	T	C	8: 61,877,361	S161G	probably benign	Het
Paqr9	T	A	9: 95,561,069	F371I	probably benign	Het
Pear1	A	T	3: 87,758,359	C120*	probably null	Het
Pla2g4e	A	T	2: 120,182,811	F343I	probably damaging	Het
Plxdc2	A	T	2: 16,512,091	Y61F	probably benign	Het
Polh	G	A	17: 46,188,088	Q234*	probably null	Het
Prkce	T	A	17: 86,496,035	M454K	possibly damaging	Het
Proser1	C	A	3: 53,477,945	T416K	probably benign	Het
Prr14l	G	T	5: 32,831,828		probably benign	Het
Rabgap1l	A	T	1: 160,738,957	D90E	probably benign	Het
Rp1l1	T	A	14: 64,028,966	V667D	possibly damaging	Het
Rpp40	A	T	13: 35,898,621	C256*	probably null	Het
Rps6ka5	A	G	12: 100,678,538	L51P	probably damaging	Het
Rtp2	C	T	16: 23,927,707	C78Y	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc6a21	T	G	7: 45,282,773		probably null	Het
Slc9a3r1	A	T	11: 115,176,444	I174F	probably damaging	Het
Smo	A	G	6: 29,757,314	Y476C	probably damaging	Het
Tacr3	A	T	3: 134,854,860	T187S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tasp1	T	C	2: 140,048,244	K71E	possibly damaging	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem41a	T	C	16: 21,946,161		probably null	Het
Tmem63a	A	G	1: 180,965,540	N459D	probably benign	Het
Ube2k	A	G	5: 65,594,926	T151A	probably damaging	Het
Ubr1	T	C	2: 120,942,553	E402G	probably benign	Het
Ulk4	T	A	9: 121,152,182	I897F	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Wdr17	C	T	8: 54,632,381	V1236M	probably damaging	Het
Zbtb32	T	C	7: 30,591,493	K126E	possibly damaging	Het
Zeb1	A	T	18: 5,767,681	S731C	possibly damaging	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112660149	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112663012	splice site	probably benign
IGL00785:Ryr3	APN	2	112836103	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112886589	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112728934	splice site	probably benign
IGL00970:Ryr3	APN	2	112764676	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112751846	splice site	probably benign
IGL01105:Ryr3	APN	2	112751805	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112709073	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112660054	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112672248	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112825883	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112772728	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112650111	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112801320	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112803158	splice site	probably benign
IGL01907:Ryr3	APN	2	112869001	splice site	probably benign
IGL02005:Ryr3	APN	2	112663263	splice site	probably benign
IGL02014:Ryr3	APN	2	112946915	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112949157	missense	probably benign
IGL02178:Ryr3	APN	2	112825799	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112967203	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112754838	splice site	probably benign
IGL02200:Ryr3	APN	2	112849510	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112964356	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112645277	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112834114	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112847399	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112947004	splice site	probably benign
IGL02398:Ryr3	APN	2	112847422	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112754958	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112900905	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112833990	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112681728	splice site	probably benign
IGL02585:Ryr3	APN	2	112712303	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112902576	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112844623	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112652841	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112668120	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112800047	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112675974	splice site	probably benign
IGL03137:Ryr3	APN	2	112910397	missense	probably benign
IGL03166:Ryr3	APN	2	112641112	nonsense	probably null
IGL03177:Ryr3	APN	2	113028671	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112632142	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112954336	nonsense	probably null
IGL03249:Ryr3	APN	2	112640656	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112756599	missense	possibly damaging	0.69
intruder	UTSW	2	112672246	nonsense	probably null
usurper	UTSW	2	112800022	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112831230	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112766338	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112841876	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112859763	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112803165	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112686810	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112647123	splice site	probably benign
R0306:Ryr3	UTSW	2	112775655	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112866054	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112661701	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112678481	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112662555	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112648306	splice site	probably benign
R0735:Ryr3	UTSW	2	112732982	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112756327	splice site	probably benign
R0789:Ryr3	UTSW	2	112780973	splice site	probably null
R0835:Ryr3	UTSW	2	112650138	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113030243	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112653702	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112869108	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112733014	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112946987	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112964380	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112958176	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112645285	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112779963	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112750803	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112645259	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112757701	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112753002	splice site	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1474:Ryr3	UTSW	2	112909962	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112636522	splice site	probably benign
R1513:Ryr3	UTSW	2	112709197	nonsense	probably null
R1524:Ryr3	UTSW	2	112869082	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112678090	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112653505	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112900833	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112709273	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112860460	missense	probably damaging	1.00
R1769:Ryr3	UTSW	2	112751768	critical splice donor site	probably null
R1776:Ryr3	UTSW	2	112957253	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112867292	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112750820	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112730328	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112709137	missense	possibly damaging	0.94
R1960:Ryr3	UTSW	2	112794467	missense	probably damaging	1.00
R1994:Ryr3	UTSW	2	112654492	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112647016	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112756641	missense	probably damaging	1.00
R2060:Ryr3	UTSW	2	112954364	missense	possibly damaging	0.92
R2061:Ryr3	UTSW	2	112663004	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112946957	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112638129	missense	probably damaging	1.00
R2140:Ryr3	UTSW	2	112875148	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112666335	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112801392	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112686628	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112675904	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112675874	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112640281	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112656531	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112751787	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112754913	missense	probably benign
R3909:Ryr3	UTSW	2	112636608	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112841873	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113028703	splice site	probably benign
R3927:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112675837	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112900908	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112926983	splice site	probably null
R4156:Ryr3	UTSW	2	112653675	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112794470	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112910407	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112946844	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112730308	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112831224	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112653102	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112653621	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112755174	splice site	probably null
R4589:Ryr3	UTSW	2	112875133	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112652763	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112996555	intron	probably benign
R4710:Ryr3	UTSW	2	112766301	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112910502	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112803268	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112757639	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112733031	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112912236	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112652745	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112648373	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112908462	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112831185	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112836257	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112635777	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112909973	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112640171	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112831159	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112902665	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112646927	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112670660	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112757667	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112755150	missense	probably damaging	1.00
R5206:Ryr3	UTSW	2	112844711	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112718002	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112653213	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112902693	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112834125	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112775841	splice site	probably null
R5434:Ryr3	UTSW	2	112794469	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112730302	splice site	probably null
R5501:Ryr3	UTSW	2	112662504	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112754877	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112841948	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112900984	nonsense	probably null
R5731:Ryr3	UTSW	2	112641572	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112753097	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112652998	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112686580	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112859731	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113030292	intron	probably benign
R5911:Ryr3	UTSW	2	112908487	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112647049	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112834064	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112672269	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112908493	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112635396	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112757670	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112954294	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112841899	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112656544	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112632185	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112675933	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112660068	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112867378	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112753088	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112652610	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112946906	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112958175	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112860354	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112831200	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112686825	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112766311	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112875091	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112753078	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112949130	nonsense	probably null
R7166:Ryr3	UTSW	2	112875028	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112900843	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113028644	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112766319	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112861852	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112672246	nonsense	probably null
R7293:Ryr3	UTSW	2	112902603	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112763665	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112640157	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112780977	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112728866	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112926957	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112678093	missense	probably benign	0.16
R7481:Ryr3	UTSW	2	112678094	missense	possibly damaging	0.95
R7497:Ryr3	UTSW	2	112730473	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112712361	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112712429	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112753027	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112645245	nonsense	probably null
R7677:Ryr3	UTSW	2	112833900	missense	probably benign
R7703:Ryr3	UTSW	2	112859765	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112635346	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112775695	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112926838	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112678517	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112730428	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112926912	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112646950	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112781024	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112669249	small deletion	probably benign
R8018:Ryr3	UTSW	2	112678432	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112775664	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112875077	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112668043	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112670270	splice site	probably null
R8181:Ryr3	UTSW	2	112778243	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112640617	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112662510	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112652925	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112653130	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112996584	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112841894	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112653780	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112675870	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112949088	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112800022	missense	probably damaging	1.00
RF010:Ryr3	UTSW	2	112775670	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112640159	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112912302	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112900916	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112675920	missense	probably benign	0.05
Z1176:Ryr3	UTSW	2	112712374	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112728924	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACGGGGAACTTTCTTAGAAGAAC -3'
(R):5'- TTCAGAGAGTCACTGAGCCC -3'

Sequencing Primer
(F):5'- CAGGAGAGATGTAAATGAGACTTACC -3'
(R):5'- AGAGAGTCACTGAGCCCCTCTC -3'

Posted On

2014-09-17