Incidental Mutation 'R2131:Rbm12'
ID228033
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene NameRNA binding motif protein 12
SynonymsSWAN, 5730420G12Rik, 9430070C08Rik
MMRRC Submission 040134-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R2131 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156091958-156111978 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 156095510 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 947 (C947*)
Ref Sequence ENSEMBL: ENSMUSP00000105233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000128499] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000138068] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect probably null
Transcript: ENSMUST00000059647
AA Change: C947*
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824
AA Change: C947*

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109604
AA Change: C947*
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824
AA Change: C947*

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
4931408C20Rik T C 1: 26,685,854 R82G probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Acvr2b A G 9: 119,432,808 R437G probably damaging Het
Adamtsl3 C A 7: 82,578,594 A1329E probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adra1a A T 14: 66,727,532 I324F possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Ampd1 G T 3: 103,094,878 probably null Het
Ankrd16 T A 2: 11,783,695 D211E probably damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Arap2 T C 5: 62,677,958 N747S probably damaging Het
Arsk A T 13: 76,091,812 C47* probably null Het
Atp8b5 T A 4: 43,370,726 F1001I probably benign Het
Bap1 T A 14: 31,258,331 Y645* probably null Het
Brca2 A G 5: 150,557,129 Y2760C probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Cdkn2c A C 4: 109,665,063 N28K probably null Het
Celsr1 T A 15: 85,963,223 I1438F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cldn1 G C 16: 26,371,550 A26G probably damaging Het
Col20a1 T A 2: 180,992,573 F110L probably damaging Het
Creg2 T C 1: 39,624,978 N204S probably benign Het
Cx3cl1 C A 8: 94,779,573 Q69K probably benign Het
Cyfip2 T C 11: 46,286,131 E74G possibly damaging Het
Cyp2g1 A T 7: 26,820,710 I456F probably damaging Het
Dapk1 A G 13: 60,729,531 E528G possibly damaging Het
Dapk1 T A 13: 60,761,667 W1365R possibly damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Depdc5 T A 5: 32,990,781 L1469* probably null Het
Dnah3 T A 7: 119,967,759 T2415S possibly damaging Het
Dnmbp A G 19: 43,854,311 L1210S probably damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Fam171b T A 2: 83,879,858 S625T probably damaging Het
Fam186a T C 15: 99,933,676 probably benign Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Gabra4 G T 5: 71,641,224 D137E probably benign Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm43302 T C 5: 105,274,744 D474G probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr19 T C 6: 134,870,442 M1V probably null Het
Hnf4a T A 2: 163,547,418 N29K probably benign Het
Htt A G 5: 34,877,109 R1975G possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Il4i1 G A 7: 44,840,070 V420M probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd4 A T 11: 59,454,955 H287L probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Kdm5d T C Y: 941,483 L1228P probably benign Het
Klra3 A G 6: 130,335,775 S9P probably benign Het
Ldhd C T 8: 111,628,537 probably null Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmo7 A T 14: 101,900,238 D670V probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lrp5 T C 19: 3,622,708 T534A possibly damaging Het
Lrrc24 A T 15: 76,715,581 F453I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Med4 A G 14: 73,517,996 N248S possibly damaging Het
Mest C T 6: 30,745,885 L269F probably damaging Het
Mib2 C T 4: 155,655,238 probably null Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Nbr1 T A 11: 101,566,191 probably null Het
Ncapd3 T G 9: 27,083,346 V1174G probably damaging Het
Nyap1 A C 5: 137,733,681 probably null Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr775 T C 10: 129,251,074 F180S probably benign Het
Oosp1 T C 19: 11,690,950 D23G probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Otog A T 7: 46,250,100 N275I probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pcx T C 19: 4,602,551 F189L probably benign Het
Pde6b A G 5: 108,428,203 D718G probably damaging Het
Pklr C A 3: 89,142,660 P314Q probably damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Plekho1 A G 3: 95,989,117 S347P probably damaging Het
Plxna2 G A 1: 194,644,750 D331N probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkra A T 2: 76,647,136 I75K probably damaging Het
Ptpn11 G A 5: 121,172,026 A31V probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Sarm1 A T 11: 78,475,307 C649S probably benign Het
Sept12 T A 16: 4,991,779 Q223L probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc22a21 A T 11: 53,979,733 L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 probably null Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spag6 T A 2: 18,733,097 C259* probably null Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Stk24 A T 14: 121,302,211 I191N probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tacc2 T A 7: 130,621,857 S91T possibly damaging Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tbccd1 A G 16: 22,841,989 S26P probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tor1aip2 A G 1: 156,065,349 Y467C probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Tti1 T C 2: 158,000,743 R789G probably benign Het
Ttn A T 2: 76,832,217 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2cbp A T 9: 86,372,487 probably null Het
Vav2 C A 2: 27,299,396 R176L possibly damaging Het
Wdr27 T A 17: 14,928,332 D133V probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp467 A C 6: 48,442,661 S38A probably damaging Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 156096041 intron probably benign
IGL01307:Rbm12 APN 2 156095382 intron probably benign
IGL02474:Rbm12 APN 2 156098097 missense probably damaging 1.00
IGL02596:Rbm12 APN 2 156095560 intron probably benign
IGL02601:Rbm12 APN 2 156095560 intron probably benign
IGL02603:Rbm12 APN 2 156095560 intron probably benign
IGL02608:Rbm12 APN 2 156095898 intron probably benign
IGL02679:Rbm12 APN 2 156095560 intron probably benign
IGL02691:Rbm12 APN 2 156095560 intron probably benign
IGL02693:Rbm12 APN 2 156095560 intron probably benign
IGL02702:Rbm12 APN 2 156095560 intron probably benign
IGL02703:Rbm12 APN 2 156095560 intron probably benign
IGL03407:Rbm12 APN 2 156097564 nonsense probably null
IGL02991:Rbm12 UTSW 2 156095560 intron probably benign
R0310:Rbm12 UTSW 2 156095724 intron probably benign
R1213:Rbm12 UTSW 2 156097492 nonsense probably null
R1280:Rbm12 UTSW 2 156096829 missense probably damaging 1.00
R1511:Rbm12 UTSW 2 156097536 missense probably damaging 0.98
R1951:Rbm12 UTSW 2 156097213 missense probably damaging 0.99
R2133:Rbm12 UTSW 2 156095510 nonsense probably null
R2883:Rbm12 UTSW 2 156097075 missense probably damaging 0.98
R4760:Rbm12 UTSW 2 156097128 missense probably damaging 0.99
R4783:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 156095569 intron probably benign
R5057:Rbm12 UTSW 2 156096886 missense probably benign 0.18
R5383:Rbm12 UTSW 2 156103365 utr 5 prime probably benign
R5599:Rbm12 UTSW 2 156096793 nonsense probably null
R5979:Rbm12 UTSW 2 156097759 intron probably benign
R6083:Rbm12 UTSW 2 156097726 intron probably benign
R6769:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 156095974 missense unknown
R7424:Rbm12 UTSW 2 156097303 missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 156098218 missense unknown
R7643:Rbm12 UTSW 2 156098217 missense unknown
Predicted Primers PCR Primer
(F):5'- CTACTAGGAAAACAATCTGGATGC -3'
(R):5'- CCCTGGTCTTGGAAGTGTTC -3'

Sequencing Primer
(F):5'- CAATCTGGATGCATTAATCACAGC -3'
(R):5'- ATTTGAGTGGGCCTCCAGC -3'
Posted On2014-09-17