Incidental Mutation 'R2124:Col4a2'
ID229664
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 040127-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11416070 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 443 (P443Q)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably damaging
Transcript: ENSMUST00000033899
AA Change: P443Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: P443Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145295
SMART Domains Protein: ENSMUSP00000114737
Gene: ENSMUSG00000031503

DomainStartEndE-ValueType
Pfam:Collagen 6 55 9.7e-8 PFAM
Pfam:Collagen 81 140 4.4e-12 PFAM
Pfam:Collagen 145 210 2.7e-8 PFAM
Pfam:Collagen 184 239 2.9e-8 PFAM
low complexity region 280 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148654
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
R7606:Col4a2 UTSW 8 11443571 missense probably benign 0.00
R7646:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R7712:Col4a2 UTSW 8 11425376 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCTGAAAATGCTCTTGG -3'
(R):5'- ACAGGGATTTCAGCTCACAG -3'

Sequencing Primer
(F):5'- TGGATTTCAGATTCAATGAGAGGCC -3'
(R):5'- TCCTGCTAAGTCACCGCAG -3'
Posted On2014-09-17