Incidental Mutation 'R2095:Slc33a1'
ID232023
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Namesolute carrier family 33 (acetyl-CoA transporter), member 1
SynonymsD630022N01Rik, Acatn
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63933507-63964768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63963955 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 79 (L79P)
Ref Sequence ENSEMBL: ENSMUSP00000123986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
Predicted Effect probably damaging
Transcript: ENSMUST00000029402
AA Change: L79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: L79P

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160883
AA Change: L79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: L79P

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161659
AA Change: L79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: L79P

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192898
Meta Mutation Damage Score 0.9093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63964012 missense probably benign
IGL01361:Slc33a1 APN 3 63943412 missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63943347 missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63948141 missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63943332 missense probably benign
IGL02877:Slc33a1 APN 3 63943385 missense probably benign
IGL03196:Slc33a1 APN 3 63963730 missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63963757 missense probably damaging 0.98
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63953894 missense probably benign
R1513:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R1618:Slc33a1 UTSW 3 63948229 missense possibly damaging 0.66
R2038:Slc33a1 UTSW 3 63948156 missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63963724 missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63963746 missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63943288 missense probably benign
R6425:Slc33a1 UTSW 3 63964063 missense probably benign
R6641:Slc33a1 UTSW 3 63953906 missense probably benign 0.09
R6709:Slc33a1 UTSW 3 63944701 missense possibly damaging 0.89
R6866:Slc33a1 UTSW 3 63943323 missense probably benign 0.02
R7360:Slc33a1 UTSW 3 63947654 missense possibly damaging 0.87
R7768:Slc33a1 UTSW 3 63947618 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGTATACTGAGTAGGGACAAGCC -3'
(R):5'- CATGTTTAGCCACGCTCTGG -3'

Sequencing Primer
(F):5'- GGACTTGCGACGACCAAAGTTC -3'
(R):5'- TTAGCCACGCTCTGGATATGAAG -3'
Posted On2014-09-18