Incidental Mutation 'R7768:Slc33a1'
ID598361
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Namesolute carrier family 33 (acetyl-CoA transporter), member 1
SynonymsD630022N01Rik, Acatn
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R7768 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63933507-63964768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63947618 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 407 (F407S)
Ref Sequence ENSEMBL: ENSMUSP00000029402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029402
AA Change: F407S

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: F407S

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160883
AA Change: F407S

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: F407S

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161659
AA Change: F407S

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: F407S

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,792,742 Y25N probably damaging Het
Actn2 A G 13: 12,282,594 V479A possibly damaging Het
Acy1 G A 9: 106,433,618 T317M possibly damaging Het
Adgrg6 A T 10: 14,431,666 D797E probably benign Het
Ank1 C T 8: 23,097,997 A552V probably benign Het
Ankrd13c A G 3: 157,988,647 T262A probably benign Het
Ap4e1 A T 2: 127,046,934 N468Y probably damaging Het
Apbb1 T C 7: 105,567,088 I367V probably benign Het
Arl6 A G 16: 59,632,336 I33T probably damaging Het
Asgr2 T C 11: 70,105,416 I228T probably damaging Het
Aspn A G 13: 49,557,395 H172R probably damaging Het
Bclaf1 T A 10: 20,339,771 F868L probably benign Het
Cacna1i G A 15: 80,381,188 R1547H probably damaging Het
Celsr1 G T 15: 85,932,409 Q1778K probably benign Het
Cep250 T C 2: 155,986,009 L42S Het
Clnk C A 5: 38,768,158 R100L probably damaging Het
Cpvl A G 6: 53,896,491 V420A possibly damaging Het
Dicer1 C A 12: 104,706,697 G825V probably damaging Het
Dmxl2 T C 9: 54,380,939 Y2628C probably damaging Het
Dnah7b T A 1: 46,137,474 H751Q probably benign Het
Dnhd1 C A 7: 105,721,095 R4576S possibly damaging Het
Dzip1 A T 14: 118,879,498 D775E probably benign Het
Erich3 T A 3: 154,748,331 M381K probably benign Het
Fam193a A G 5: 34,465,791 D1241G possibly damaging Het
Gbx2 A G 1: 89,928,984 L228P probably benign Het
Ggt7 A T 2: 155,506,501 M77K possibly damaging Het
Gm12800 A C 4: 101,911,813 I454L probably benign Het
Gpr26 T A 7: 131,974,348 I247K probably damaging Het
Grip1 A G 10: 120,038,397 T745A probably damaging Het
Gusb A T 5: 130,000,405 H178Q probably benign Het
Hacl1 T C 14: 31,616,480 Y380C probably damaging Het
Hdac9 T C 12: 34,390,240 H380R possibly damaging Het
Icam4 T A 9: 21,029,994 L143Q probably damaging Het
Ikbkb T A 8: 22,695,236 I43F probably damaging Het
Ints11 G T 4: 155,886,939 K303N probably damaging Het
Itpa A T 2: 130,667,916 N16I probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kat6a T A 8: 22,903,212 N235K probably damaging Het
Kmt2a C T 9: 44,820,603 V2806I unknown Het
Loxhd1 T A 18: 77,384,941 F1051L probably damaging Het
Map2 A G 1: 66,414,483 E844G possibly damaging Het
Mmp7 T A 9: 7,697,748 Y261* probably null Het
Muc4 A C 16: 32,756,194 M2023L unknown Het
Mybpc1 C A 10: 88,542,372 G688V probably damaging Het
Myo3a A G 2: 22,241,143 T34A probably damaging Het
Nrxn2 A G 19: 6,481,379 T683A possibly damaging Het
Nup160 A G 2: 90,700,116 I444V probably damaging Het
Olfr1132 T C 2: 87,635,313 M145V probably benign Het
Olfr1291-ps1 A C 2: 111,499,853 K200N possibly damaging Het
Olfr329-ps A T 11: 58,542,640 S292T probably damaging Het
Olfr329-ps A T 11: 58,542,867 M216K possibly damaging Het
Pcdha1 A G 18: 36,932,167 E628G probably damaging Het
Pcdha12 T C 18: 37,022,351 S708P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y not run Het
Pkd1l2 A G 8: 117,054,860 probably null Het
Pla2g6 T C 15: 79,297,314 D577G probably damaging Het
Pla2r1 G T 2: 60,448,946 D763E probably benign Het
Psg18 A T 7: 18,346,028 I416N probably damaging Het
Rapgef6 G T 11: 54,626,588 V369F probably damaging Het
Rasal3 T C 17: 32,396,793 E357G probably damaging Het
Rhbdl3 G A 11: 80,330,621 R195Q probably benign Het
Rnf216 A T 5: 143,098,444 M1K probably null Het
Rspry1 C A 8: 94,629,841 D165E probably damaging Het
Rwdd2b G A 16: 87,436,745 L156F probably benign Het
Scn11a T A 9: 119,815,272 I141F probably benign Het
Sirt2 A T 7: 28,782,859 T198S probably benign Het
Slc2a1 A G 4: 119,132,447 N94D probably damaging Het
Slc38a4 A C 15: 97,008,664 L356R probably damaging Het
Slc43a1 T A 2: 84,856,871 L372Q probably damaging Het
Slc6a6 T A 6: 91,739,965 I274N probably damaging Het
Smchd1 C T 17: 71,411,911 G821D probably damaging Het
Spata33 T C 8: 123,214,407 F65S unknown Het
Stx19 A G 16: 62,822,204 T128A probably benign Het
Tas2r103 T C 6: 133,036,849 M85V probably benign Het
Tas2r117 C T 6: 132,803,522 L208F probably damaging Het
Tcirg1 A T 19: 3,902,900 I233N possibly damaging Het
Uba6 C A 5: 86,152,920 W192L probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Unc80 T C 1: 66,510,595 S671P possibly damaging Het
Usp8 A G 2: 126,751,123 Q766R probably damaging Het
Vmn2r103 A G 17: 19,812,052 N696S probably damaging Het
Vmn2r14 G A 5: 109,220,220 T302I probably benign Het
Vmn2r50 G A 7: 10,037,371 A801V probably damaging Het
Vmn2r85 T G 10: 130,418,693 Q707H probably damaging Het
Wsb2 G A 5: 117,363,722 V51M probably benign Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp442 T C 2: 150,408,321 K554E possibly damaging Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63964012 missense probably benign
IGL01361:Slc33a1 APN 3 63943412 missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63943347 missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63948141 missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63943332 missense probably benign
IGL02877:Slc33a1 APN 3 63943385 missense probably benign
IGL03196:Slc33a1 APN 3 63963730 missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63963757 missense probably damaging 0.98
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63953894 missense probably benign
R1513:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R1618:Slc33a1 UTSW 3 63948229 missense possibly damaging 0.66
R2038:Slc33a1 UTSW 3 63948156 missense probably damaging 1.00
R2095:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63963724 missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63963746 missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63943288 missense probably benign
R6425:Slc33a1 UTSW 3 63964063 missense probably benign
R6641:Slc33a1 UTSW 3 63953906 missense probably benign 0.09
R6709:Slc33a1 UTSW 3 63944701 missense possibly damaging 0.89
R6866:Slc33a1 UTSW 3 63943323 missense probably benign 0.02
R7360:Slc33a1 UTSW 3 63947654 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTAACTCATAGGGAAATCTTCAACTTC -3'
(R):5'- ACATCGTCAGTGTCATTTGGG -3'

Sequencing Primer
(F):5'- TTCTTCAGGGACTAGAAGACAGCTC -3'
(R):5'- CCTCCTGAGTCTGAGATTGAAGAC -3'
Posted On2019-11-26