Incidental Mutation 'R0173:Vipas39'
ID23728
Institutional Source Beutler Lab
Gene Symbol Vipas39
Ensembl Gene ENSMUSG00000021038
Gene NameVPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R0173 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87238868-87266256 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 87250511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021426] [ENSMUST00000072744] [ENSMUST00000179379]
Predicted Effect probably benign
Transcript: ENSMUST00000021426
SMART Domains Protein: ENSMUSP00000021426
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072744
SMART Domains Protein: ENSMUSP00000072527
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 489 3.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179379
SMART Domains Protein: ENSMUSP00000137190
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222350
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry and scaly skin, hair loss, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Vipas39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL01418:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL02026:Vipas39 APN 12 87251709 splice site probably benign
IGL03089:Vipas39 APN 12 87253254 missense probably damaging 1.00
R0909:Vipas39 UTSW 12 87241331 missense probably benign 0.21
R1505:Vipas39 UTSW 12 87246160 missense probably damaging 1.00
R2897:Vipas39 UTSW 12 87242523 missense possibly damaging 0.78
R2968:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2969:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2970:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R4622:Vipas39 UTSW 12 87244543 missense probably damaging 1.00
R4676:Vipas39 UTSW 12 87241301 missense probably damaging 1.00
R5181:Vipas39 UTSW 12 87239827 missense probably damaging 1.00
R5188:Vipas39 UTSW 12 87254247 missense probably benign 0.21
R5881:Vipas39 UTSW 12 87251807 nonsense probably null
R6080:Vipas39 UTSW 12 87241953 missense probably damaging 1.00
R6425:Vipas39 UTSW 12 87241289 missense probably damaging 0.98
R6896:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R7438:Vipas39 UTSW 12 87241931 splice site probably null
R7538:Vipas39 UTSW 12 87263903 critical splice donor site probably null
R8436:Vipas39 UTSW 12 87257417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTATGGGTGGAGACTAAGCTAGGC -3'
(R):5'- GGCTAGGGCAGGCTGTATTTAAGC -3'

Sequencing Primer
(F):5'- AAGCTAGGCAGTGTCATTTCC -3'
(R):5'- GCAGGCTGTATTTAAGCTCTTAC -3'
Posted On2013-04-16