Mutagenetix > Incidental Mutations

Incidental Mutation 'R0173:Sdk1'

23707

Institutional Source

Beutler Lab

Gene Symbol

Sdk1

Ensembl Gene

ENSMUSG00000039683

Gene Name

sidekick cell adhesion molecule 1

Synonyms

6720466O15Rik

MMRRC Submission

038445-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R0173 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141241490-142215586 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 142173809 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000082928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]

Predicted Effect

probably benign
Transcript: ENSMUST00000074546

SMART Domains

Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683

Domain	Start	End	E-Value	Type
IGc2	28	91	4.67e-4	SMART
IGc2	121	187	1.45e-9	SMART
IGc2	214	282	1.58e-10	SMART
IG	302	387	1.8e-5	SMART
FN3	390	474	7.39e-14	SMART
FN3	490	576	8.96e-13	SMART
FN3	591	679	1.95e-4	SMART
FN3	694	776	2e-10	SMART
FN3	792	879	4.22e-9	SMART
FN3	896	983	1.41e-10	SMART
FN3	999	1084	2.7e-7	SMART
FN3	1100	1183	1.3e-9	SMART
FN3	1199	1284	2.19e-7	SMART
FN3	1300	1408	5.73e-11	SMART
FN3	1424	1509	1.79e-12	SMART
FN3	1524	1611	1.16e-11	SMART
FN3	1625	1709	1.32e-10	SMART
transmembrane domain	1730	1752	N/A	INTRINSIC
low complexity region	1806	1815	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085774

SMART Domains

Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
IGc2	99	158	2.77e-6	SMART
IG	179	264	3.74e-3	SMART
IGc2	288	351	4.67e-4	SMART
IGc2	381	447	1.45e-9	SMART
IGc2	474	542	1.58e-10	SMART
IG	562	647	1.8e-5	SMART
FN3	650	734	7.39e-14	SMART
FN3	750	836	8.96e-13	SMART
FN3	851	939	1.95e-4	SMART
FN3	954	1036	2e-10	SMART
FN3	1052	1139	4.22e-9	SMART
FN3	1156	1243	1.41e-10	SMART
FN3	1259	1344	2.7e-7	SMART
FN3	1360	1443	1.3e-9	SMART
FN3	1459	1544	2.19e-7	SMART
FN3	1560	1668	5.73e-11	SMART
FN3	1684	1769	1.79e-12	SMART
FN3	1784	1871	1.16e-11	SMART
FN3	1885	1969	1.32e-10	SMART
transmembrane domain	1990	2012	N/A	INTRINSIC
low complexity region	2066	2075	N/A	INTRINSIC
low complexity region	2106	2118	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 95.1%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A330008L17Rik	G	A	8: 99,421,654		noncoding transcript	Het
Akt1s1	C	T	7: 44,852,860	P95S	possibly damaging	Het
Ambra1	T	C	2: 91,810,219		probably benign	Het
Aunip	T	A	4: 134,523,550	W269R	probably damaging	Het
Bmper	A	G	9: 23,224,829	M69V	probably benign	Het
Cdh2	A	T	18: 16,650,257		probably benign	Het
Cenpe	T	C	3: 135,259,983	M2074T	probably benign	Het
Col14a1	C	T	15: 55,488,532	P1592S	probably damaging	Het
Csgalnact1	G	A	8: 68,461,029	R175C	probably damaging	Het
Dtx1	A	G	5: 120,682,753		probably benign	Het
Elmod3	T	C	6: 72,577,588	D154G	probably damaging	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Gab1	T	C	8: 80,800,160	D103G	possibly damaging	Het
Gon4l	A	G	3: 88,858,403	D377G	probably damaging	Het
Gramd1c	C	T	16: 43,997,833	R328K	possibly damaging	Het
Hdac3	A	G	18: 37,941,753	S312P	probably damaging	Het
Hmcn2	T	C	2: 31,438,331		probably null	Het
Intu	T	C	3: 40,675,346		probably null	Het
Lnpk	T	C	2: 74,551,065	K118R	probably damaging	Het
Lzts3	A	C	2: 130,634,768	*587G	probably null	Het
Mctp2	C	T	7: 72,247,107		probably null	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mmp23	G	T	4: 155,650,765	R374S	possibly damaging	Het
Morc3	G	A	16: 93,832,206		probably null	Het
Mymk	C	T	2: 27,062,250	A161T	probably damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Neb	T	C	2: 52,243,847	S3375G	probably damaging	Het
Nedd1	T	C	10: 92,698,883	D255G	probably benign	Het
Nid2	T	C	14: 19,802,332		probably benign	Het
Nr1d2	A	G	14: 18,215,502		probably benign	Het
Nus1	A	G	10: 52,417,998	H86R	possibly damaging	Het
Olfr1474	A	T	19: 13,471,701	I244F	probably benign	Het
Olfr829	A	G	9: 18,857,029	I135V	probably damaging	Het
Plcxd2	A	T	16: 45,965,179		probably null	Het
Prdm9	T	A	17: 15,544,013	D835V	probably benign	Het
Prdm9	A	G	17: 15,544,035	W828R	probably benign	Het
Prkd2	T	C	7: 16,849,044	S244P	probably benign	Het
Psmd4	A	T	3: 95,032,923	L159H	probably damaging	Het
Qprt	C	T	7: 127,108,371	G215E	probably damaging	Het
Rab3gap2	C	A	1: 185,249,907	H385Q	possibly damaging	Het
Rapgef5	A	G	12: 117,688,676	D300G	probably benign	Het
Rbl1	A	T	2: 157,159,685	N894K	probably benign	Het
Rgma	C	T	7: 73,417,554	R280W	probably damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rundc3a	T	A	11: 102,398,245		probably benign	Het
Scaf11	A	T	15: 96,420,194	D496E	probably benign	Het
Scn9a	T	C	2: 66,533,093	Y936C	probably damaging	Het
Serpinb9	G	A	13: 33,010,722	D154N	probably benign	Het
Slc48a1	A	T	15: 97,790,674	H131L	possibly damaging	Het
Slco1a6	T	C	6: 142,103,122	N311D	probably benign	Het
Sorl1	A	G	9: 42,067,933	V423A	probably damaging	Het
Srrm2	C	A	17: 23,815,129		probably benign	Het
Srsf12	A	T	4: 33,226,117	S122C	probably damaging	Het
Suclg2	G	C	6: 95,475,173		probably benign	Het
Tbpl1	A	T	10: 22,707,624	L149*	probably null	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Tmem63a	T	C	1: 180,954,798		probably benign	Het
Tut1	C	T	19: 8,965,483	R645*	probably null	Het
Ubqln4	T	A	3: 88,555,379	D50E	probably benign	Het
Ubr5	A	G	15: 38,004,675	S1227P	probably damaging	Het
Vipas39	A	G	12: 87,250,511		probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps26b	G	A	9: 27,012,805	T214I	probably benign	Het
Xpc	A	G	6: 91,504,735		probably benign	Het

Other mutations in Sdk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Sdk1	APN	5	142085606	missense	probably damaging	1.00
IGL00945:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL00946:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL01394:Sdk1	APN	5	141613215	missense	probably benign	0.03
IGL01398:Sdk1	APN	5	141937577	missense	probably benign	0.00
IGL01410:Sdk1	APN	5	142212120	missense	probably benign	0.30
IGL01525:Sdk1	APN	5	141999920	missense	probably damaging	1.00
IGL01548:Sdk1	APN	5	142085765	missense	possibly damaging	0.95
IGL01672:Sdk1	APN	5	142185175	missense	probably benign	0.33
IGL01676:Sdk1	APN	5	142127836	missense	probably damaging	0.99
IGL01679:Sdk1	APN	5	142046164	missense	probably benign
IGL01929:Sdk1	APN	5	141953030	missense	probably damaging	0.99
IGL01970:Sdk1	APN	5	142085682	missense	possibly damaging	0.67
IGL02016:Sdk1	APN	5	142034429	missense	possibly damaging	0.85
IGL02060:Sdk1	APN	5	141953012	missense	possibly damaging	0.79
IGL02457:Sdk1	APN	5	141953016	missense	probably damaging	1.00
IGL02634:Sdk1	APN	5	141610032	missense	probably benign	0.01
IGL02637:Sdk1	APN	5	142094572	missense	probably damaging	1.00
IGL02731:Sdk1	APN	5	142172544	missense	probably damaging	1.00
IGL03180:Sdk1	APN	5	142085742	missense	probably damaging	0.96
IGL03259:Sdk1	APN	5	141953033	nonsense	probably null
PIT4453001:Sdk1	UTSW	5	142212038	missense	probably benign	0.00
PIT4544001:Sdk1	UTSW	5	141956232	missense	probably benign	0.08
R0149:Sdk1	UTSW	5	141857054	intron	probably benign
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0242:Sdk1	UTSW	5	142143922	splice site	probably benign
R0245:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0270:Sdk1	UTSW	5	142084566	missense	possibly damaging	0.79
R0398:Sdk1	UTSW	5	141962721	missense	probably benign	0.05
R0401:Sdk1	UTSW	5	142046161	missense	possibly damaging	0.55
R0501:Sdk1	UTSW	5	141937718	missense	probably benign
R0558:Sdk1	UTSW	5	142132065	missense	probably damaging	1.00
R0652:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0834:Sdk1	UTSW	5	141242024	missense	probably benign
R0962:Sdk1	UTSW	5	142161875	missense	probably damaging	1.00
R1424:Sdk1	UTSW	5	142161866	missense	probably damaging	1.00
R1438:Sdk1	UTSW	5	142038323	missense	probably damaging	0.96
R1517:Sdk1	UTSW	5	142127836	missense	probably damaging	0.99
R1519:Sdk1	UTSW	5	141999950	missense	probably benign	0.00
R1539:Sdk1	UTSW	5	142094599	missense	probably damaging	1.00
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1673:Sdk1	UTSW	5	141948506	missense	possibly damaging	0.90
R1686:Sdk1	UTSW	5	142034537	missense	probably benign	0.00
R1806:Sdk1	UTSW	5	141613195	missense	probably damaging	1.00
R1806:Sdk1	UTSW	5	142161926	missense	probably benign
R1925:Sdk1	UTSW	5	142185285	missense	probably benign	0.09
R1956:Sdk1	UTSW	5	142094581	missense	probably damaging	1.00
R1976:Sdk1	UTSW	5	142143818	missense	probably damaging	1.00
R2124:Sdk1	UTSW	5	142185188	missense	possibly damaging	0.70
R2152:Sdk1	UTSW	5	141792944	missense	probably damaging	1.00
R2186:Sdk1	UTSW	5	142046292	missense	probably benign	0.00
R2187:Sdk1	UTSW	5	142114574	missense	probably damaging	1.00
R2306:Sdk1	UTSW	5	141962700	missense	probably benign	0.00
R2520:Sdk1	UTSW	5	142085771	missense	probably benign	0.19
R2698:Sdk1	UTSW	5	142212050	missense	possibly damaging	0.95
R2763:Sdk1	UTSW	5	142084551	missense	possibly damaging	0.90
R3023:Sdk1	UTSW	5	142046236	missense	probably benign
R3500:Sdk1	UTSW	5	142006616	splice site	probably benign
R3613:Sdk1	UTSW	5	142119686	missense	probably damaging	1.00
R3824:Sdk1	UTSW	5	141936049	missense	probably benign
R3916:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R3917:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R4158:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4160:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4161:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4386:Sdk1	UTSW	5	142094626	missense	probably damaging	0.99
R4649:Sdk1	UTSW	5	142006625	missense	probably damaging	1.00
R4701:Sdk1	UTSW	5	142185231	missense	probably damaging	1.00
R4780:Sdk1	UTSW	5	141959238	missense	probably damaging	0.97
R4787:Sdk1	UTSW	5	141582413	missense	probably benign
R4825:Sdk1	UTSW	5	141582294	missense	probably benign	0.11
R4853:Sdk1	UTSW	5	142146263	missense	probably damaging	1.00
R4857:Sdk1	UTSW	5	142161776	missense	probably benign	0.01
R4928:Sdk1	UTSW	5	141857003	intron	probably benign
R5111:Sdk1	UTSW	5	142127845	missense	probably damaging	1.00
R5188:Sdk1	UTSW	5	141956260	critical splice donor site	probably null
R5246:Sdk1	UTSW	5	142114562	missense	possibly damaging	0.72
R5273:Sdk1	UTSW	5	141998828	missense	probably damaging	0.99
R5484:Sdk1	UTSW	5	142100186	missense	probably damaging	1.00
R5525:Sdk1	UTSW	5	142185265	missense	possibly damaging	0.84
R5578:Sdk1	UTSW	5	141613125	nonsense	probably null
R5593:Sdk1	UTSW	5	141956124	missense	probably damaging	0.98
R5654:Sdk1	UTSW	5	141936098	missense	probably damaging	0.96
R5672:Sdk1	UTSW	5	142188145	missense	possibly damaging	0.94
R5768:Sdk1	UTSW	5	142143871	missense	probably benign	0.00
R5781:Sdk1	UTSW	5	141936048	missense	probably benign	0.00
R5846:Sdk1	UTSW	5	142114393	missense	probably damaging	1.00
R5851:Sdk1	UTSW	5	141962669	missense	probably benign	0.00
R6164:Sdk1	UTSW	5	142132069	missense	probably damaging	1.00
R6235:Sdk1	UTSW	5	142034426	missense	possibly damaging	0.85
R6364:Sdk1	UTSW	5	141962709	missense	probably benign	0.00
R6453:Sdk1	UTSW	5	142096921	missense	probably damaging	1.00
R6892:Sdk1	UTSW	5	142046298	missense	probably benign	0.00
R6996:Sdk1	UTSW	5	142212014	missense	probably benign	0.16
R7003:Sdk1	UTSW	5	142096734	missense	probably benign	0.01
R7022:Sdk1	UTSW	5	142094657	intron	probably null
R7027:Sdk1	UTSW	5	142096726	splice site	probably null
R7098:Sdk1	UTSW	5	142096870	missense	probably damaging	0.96
R7107:Sdk1	UTSW	5	142081716	missense	probably damaging	0.99
R7203:Sdk1	UTSW	5	142046176	missense	probably benign	0.08
R7313:Sdk1	UTSW	5	141937622	missense	probably damaging	0.97
R7363:Sdk1	UTSW	5	142188142	missense	probably benign	0.05
R7375:Sdk1	UTSW	5	141998843	missense	probably benign	0.01
R7446:Sdk1	UTSW	5	142144976	missense	probably damaging	1.00
R7527:Sdk1	UTSW	5	141792976	missense	possibly damaging	0.61
R7598:Sdk1	UTSW	5	141609998	nonsense	probably null
R7747:Sdk1	UTSW	5	142084491	missense	probably damaging	1.00
R7810:Sdk1	UTSW	5	141937679	missense	probably benign
X0017:Sdk1	UTSW	5	141998780	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGACTGTCCTCAGTCCCCTCAAAAC -3'
(R):5'- AGGCATCAGAAATTGAATGCCCGAG -3'

Sequencing Primer
(F):5'- GTCCCCTCAAAACCAATATCTACTC -3'
(R):5'- TGCCCGAGAGGTTAACAGC -3'

Posted On

2013-04-16