Incidental Mutation 'R0173:Xpc'
ID23709
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0173 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 91504735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000206476]
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150279
Predicted Effect probably benign
Transcript: ENSMUST00000206476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91510481 missense probably damaging 1.00
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1426:Xpc UTSW 6 91493238 missense probably damaging 1.00
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
R7214:Xpc UTSW 6 91492338 missense probably damaging 1.00
R7442:Xpc UTSW 6 91504649 missense probably damaging 1.00
R7524:Xpc UTSW 6 91499531 missense probably benign 0.23
R7581:Xpc UTSW 6 91498017 splice site probably benign
R8002:Xpc UTSW 6 91492305 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCAACTGACCACTTCAGGAGAG -3'
(R):5'- GCGGGACACAAAGCCTTGGAATATG -3'

Sequencing Primer
(F):5'- CGAGTACAGTAGATGGCCTTACC -3'
(R):5'- ATGGCTGATGACATATTCCTTCG -3'
Posted On2013-04-16