Incidental Mutation 'R2249:Neto1'
ID240810
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 1
SynonymsC130005O10Rik
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location86394952-86501897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86461274 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 196 (A196S)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
Predicted Effect probably benign
Transcript: ENSMUST00000058829
AA Change: A196S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: A196S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86498812 missense probably damaging 0.98
IGL01505:Neto1 APN 18 86473689 missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86395908 missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86473823 missense probably damaging 1.00
IGL03072:Neto1 APN 18 86498589 missense probably benign 0.23
R0119:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0136:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0299:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0603:Neto1 UTSW 18 86473660 missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86404729 nonsense probably null
R0657:Neto1 UTSW 18 86461320 missense probably benign 0.17
R1395:Neto1 UTSW 18 86398019 splice site probably benign
R1648:Neto1 UTSW 18 86500054 missense probably damaging 1.00
R1852:Neto1 UTSW 18 86395884 start codon destroyed probably null 0.53
R4418:Neto1 UTSW 18 86404856 missense probably benign
R4476:Neto1 UTSW 18 86404673 missense probably damaging 0.98
R4676:Neto1 UTSW 18 86398302 missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86398281 missense probably benign
R5282:Neto1 UTSW 18 86404873 missense probably damaging 1.00
R5337:Neto1 UTSW 18 86398309 missense probably benign 0.00
R5400:Neto1 UTSW 18 86395908 missense possibly damaging 0.86
R5435:Neto1 UTSW 18 86398263 missense probably benign 0.00
R5632:Neto1 UTSW 18 86498643 missense probably benign 0.00
R5755:Neto1 UTSW 18 86499094 missense probably damaging 0.99
R6272:Neto1 UTSW 18 86494815 missense probably damaging 1.00
R6486:Neto1 UTSW 18 86461246 missense probably benign
R6505:Neto1 UTSW 18 86498574 missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86498748 missense possibly damaging 0.47
R6582:Neto1 UTSW 18 86494860 nonsense probably null
R6887:Neto1 UTSW 18 86498635 missense probably benign 0.16
R7452:Neto1 UTSW 18 86498931 missense probably benign
R7469:Neto1 UTSW 18 86498688 missense probably benign
R7795:Neto1 UTSW 18 86461073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATTGCCAGGTTGGTAAAAG -3'
(R):5'- GGTGAACACAAGTCTCATTTCC -3'

Sequencing Primer
(F):5'- GAGAAATTTGATAATGTCCAGAGGTC -3'
(R):5'- CAAGTCTCATTTCCAAGAACAGG -3'
Posted On2014-10-15