Incidental Mutation 'R2215:Plekhm1'
ID241107
Institutional Source Beutler Lab
Gene Symbol Plekhm1
Ensembl Gene ENSMUSG00000034247
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 1
SynonymsB2, D330036J23Rik, AP162
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103364275-103412687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103376985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 720 (I720N)
Ref Sequence ENSEMBL: ENSMUSP00000047327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272]
Predicted Effect probably damaging
Transcript: ENSMUST00000041272
AA Change: I720N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: I720N

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184350
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Plekhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Plekhm1 APN 11 103394783 missense possibly damaging 0.54
IGL01876:Plekhm1 APN 11 103376751 missense probably damaging 1.00
IGL02159:Plekhm1 APN 11 103380231 missense probably benign 0.04
IGL02404:Plekhm1 APN 11 103394998 missense probably benign 0.18
IGL02537:Plekhm1 APN 11 103397192 missense probably damaging 1.00
IGL02568:Plekhm1 APN 11 103395050 missense probably damaging 1.00
IGL02660:Plekhm1 APN 11 103374094 splice site probably benign
IGL03130:Plekhm1 APN 11 103377381 missense probably benign 0.17
IGL03208:Plekhm1 APN 11 103376770 missense probably benign 0.00
R0442:Plekhm1 UTSW 11 103397174 missense possibly damaging 0.45
R0491:Plekhm1 UTSW 11 103394776 missense probably benign 0.05
R0520:Plekhm1 UTSW 11 103394944 missense probably benign 0.17
R0964:Plekhm1 UTSW 11 103395082 nonsense probably null
R1189:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1501:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1697:Plekhm1 UTSW 11 103376884 missense probably damaging 1.00
R1781:Plekhm1 UTSW 11 103394856 missense probably damaging 1.00
R1873:Plekhm1 UTSW 11 103373998 missense probably benign 0.01
R2087:Plekhm1 UTSW 11 103397025 critical splice donor site probably null
R2271:Plekhm1 UTSW 11 103387122 missense probably benign 0.00
R4256:Plekhm1 UTSW 11 103370934 missense probably damaging 0.98
R4393:Plekhm1 UTSW 11 103376965 missense possibly damaging 0.51
R4526:Plekhm1 UTSW 11 103395304 missense probably damaging 0.97
R5119:Plekhm1 UTSW 11 103387315 missense possibly damaging 0.62
R5975:Plekhm1 UTSW 11 103376691 missense possibly damaging 0.49
R6389:Plekhm1 UTSW 11 103366894 missense probably benign 0.21
R6454:Plekhm1 UTSW 11 103377382 missense probably damaging 1.00
R6755:Plekhm1 UTSW 11 103387243 missense possibly damaging 0.65
R6830:Plekhm1 UTSW 11 103376889 missense probably damaging 0.97
R7039:Plekhm1 UTSW 11 103395228 missense probably damaging 1.00
R7066:Plekhm1 UTSW 11 103370988 missense possibly damaging 0.47
R7149:Plekhm1 UTSW 11 103394916 missense probably damaging 0.98
R7349:Plekhm1 UTSW 11 103387334 missense probably damaging 0.98
R7505:Plekhm1 UTSW 11 103380029 splice site probably null
R7792:Plekhm1 UTSW 11 103397060 missense probably damaging 0.99
R7867:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
R7950:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
X0058:Plekhm1 UTSW 11 103377366 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGATGCCAGCACTTTCCG -3'
(R):5'- TATCCAGTACCCAGACCAGG -3'

Sequencing Primer
(F):5'- AGCACTTTCCGGACCAGGTC -3'
(R):5'- AGTACCCAGACCAGGCTGAG -3'
Posted On2014-10-15