Incidental Mutation 'R2217:Gpat4'
List |< first << previous [record 16 of 46] next >> last >|
ID241213
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Nameglycerol-3-phosphate acyltransferase 4
SynonymsAgpat6
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location23171265-23208346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23180155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 286 (P286L)
Ref Sequence ENSEMBL: ENSMUSP00000127325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004] [ENSMUST00000209507]
Predicted Effect probably damaging
Transcript: ENSMUST00000167004
AA Change: P286L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: P286L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211260
Meta Mutation Damage Score 0.9423 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2315:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3775:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4384:Gpat4 UTSW 8 23174586 missense probably benign 0.05
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5199:Gpat4 UTSW 8 23182696 missense possibly damaging 0.46
R5491:Gpat4 UTSW 8 23180664 missense probably benign 0.38
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Z1176:Gpat4 UTSW 8 23179798 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGGACCATTTGCCCCAC -3'
(R):5'- TCACAACCAGGGGTCTAAAGAG -3'

Sequencing Primer
(F):5'- CACAGTTCCAAATTTGTTTATTGGG -3'
(R):5'- GTGGAACAGAGACTGGGGTATTTG -3'
Posted On2014-10-15