Mutagenetix > Incidental Mutations

Incidental Mutation 'R2270:Zfp729b'

242415

Institutional Source

Beutler Lab

Gene Symbol

Zfp729b

Ensembl Gene

ENSMUSG00000058093

Gene Name

zinc finger protein 729b

Synonyms

AA987161

MMRRC Submission

040270-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R2270 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67589439-67609707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67592233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 648 (C648S)

Ref Sequence

ENSEMBL: ENSMUSP00000153476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]

AlphaFold

Q80VN4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000012873
AA Change: C638S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: C638S

Domain	Start	End	E-Value	Type
KRAB	5	65	1.63e-28	SMART
ZnF_C2H2	132	154	3.58e-2	SMART
PHD	133	194	1e1	SMART
ZnF_C2H2	160	182	3.21e-4	SMART
ZnF_C2H2	188	210	6.78e-3	SMART
ZnF_C2H2	216	238	3.16e-3	SMART
PHD	217	278	7.77e0	SMART
ZnF_C2H2	244	266	6.67e-2	SMART
ZnF_C2H2	272	294	1.12e-3	SMART
ZnF_C2H2	300	322	1.79e-2	SMART
PHD	301	362	1.65e1	SMART
ZnF_C2H2	328	350	2.57e-3	SMART
ZnF_C2H2	356	378	2.43e-4	SMART
ZnF_C2H2	412	434	1.67e-2	SMART
ZnF_C2H2	440	462	1.28e-3	SMART
PHD	441	502	4.46e0	SMART
ZnF_C2H2	468	490	1.58e-3	SMART
ZnF_C2H2	496	518	2.95e-3	SMART
ZnF_C2H2	524	546	4.47e-3	SMART
PHD	525	586	5.77e0	SMART
ZnF_C2H2	552	574	5.42e-2	SMART
ZnF_C2H2	580	602	1.03e-2	SMART
ZnF_C2H2	608	630	5.5e-3	SMART
PHD	609	670	1.52e1	SMART
ZnF_C2H2	636	658	6.99e-5	SMART
ZnF_C2H2	664	686	3.34e-2	SMART
ZnF_C2H2	720	742	3.63e-3	SMART
PHD	721	782	2.67e0	SMART
ZnF_C2H2	748	770	5.42e-2	SMART
ZnF_C2H2	776	798	5.14e-3	SMART
ZnF_C2H2	804	826	4.17e-3	SMART
ZnF_C2H2	832	854	1.47e-3	SMART
PHD	833	894	4.93e0	SMART
ZnF_C2H2	860	882	3.83e-2	SMART
ZnF_C2H2	888	910	4.4e-2	SMART
ZnF_C2H2	916	938	7.78e-3	SMART
ZnF_C2H2	944	966	4.17e-3	SMART
ZnF_C2H2	972	994	1.38e-3	SMART
ZnF_C2H2	1000	1022	1.69e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133177

Predicted Effect

probably benign
Transcript: ENSMUST00000138725

SMART Domains

Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093

Domain	Start	End	E-Value	Type
KRAB	15	75	1.63e-28	SMART
ZnF_C2H2	142	164	3.58e-2	SMART
ZnF_C2H2	170	192	3.21e-4	SMART
ZnF_C2H2	198	220	6.78e-3	SMART
ZnF_C2H2	226	248	3.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223599

Predicted Effect

probably damaging
Transcript: ENSMUST00000224814
AA Change: C648S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225627

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	G	A	19: 57,077,431	R54W	possibly damaging	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atp11b	A	G	3: 35,810,134		probably null	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Chat	T	C	14: 32,454,581	R79G	probably damaging	Het
Chek1	A	G	9: 36,719,686	L144P	probably damaging	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Crip2	A	C	12: 113,144,866	K62N	probably damaging	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnm3	A	T	1: 162,477,789	L12Q	probably damaging	Het
Eftud2	T	C	11: 102,864,781	N200S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Fry	A	G	5: 150,400,924	I1151V	probably null	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gpr143	T	A	X: 152,790,570	V181E	probably damaging	Het
Gtf2f1	T	C	17: 57,003,462	I498V	probably null	Het
Ipo4	A	G	14: 55,634,100	L168P	probably damaging	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mre11a	A	G	9: 14,815,174	E411G	probably benign	Het
Mybpc1	C	A	10: 88,551,407	V106F	probably benign	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
N4bp3	A	T	11: 51,644,305	N352K	probably benign	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ncor2	A	G	5: 125,037,955	V515A	probably benign	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Olfm4	C	A	14: 80,011,875	T144K	probably damaging	Het
Olfr741	G	T	14: 50,486,037	C193F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Phf12	G	T	11: 77,984,175	A76S	possibly damaging	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prkg1	A	G	19: 30,578,631	V610A	probably benign	Het
Prrc2a	T	C	17: 35,149,536	T2104A	possibly damaging	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Ranbp2	T	C	10: 58,455,927	V252A	probably benign	Het
Rcn3	A	G	7: 45,088,651	S98P	probably damaging	Het
Rere	T	C	4: 150,477,380	S248P	unknown	Het
Rnaseh2a	T	C	8: 84,965,419	E75G	probably benign	Het
Slc15a1	A	T	14: 121,479,994	M292K	probably damaging	Het
Slc1a2	T	G	2: 102,735,994	L14R	probably damaging	Het
Slfn2	C	T	11: 83,069,935	R247C	probably damaging	Het
Ttn	T	C	2: 76,948,364	I1218M	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Yme1l1	T	C	2: 23,175,220	I247T	possibly damaging	Het
Zc3h13	T	C	14: 75,332,147	M1478T	probably benign	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Znhit2	A	G	19: 6,061,231	E2G	probably damaging	Het
Zpbp	A	T	11: 11,418,272	M133K	probably benign	Het

Other mutations in Zfp729b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02083:Zfp729b	APN	13	67595230	missense	probably benign	0.09
IGL02852:Zfp729b	APN	13	67592823	missense	probably damaging	0.99
PIT4449001:Zfp729b	UTSW	13	67591423	missense	probably benign	0.01
R0238:Zfp729b	UTSW	13	67591903	missense	probably damaging	0.98
R0238:Zfp729b	UTSW	13	67591903	missense	probably damaging	0.98
R0450:Zfp729b	UTSW	13	67591134	missense	probably benign
R0510:Zfp729b	UTSW	13	67591134	missense	probably benign
R1122:Zfp729b	UTSW	13	67595284	missense	possibly damaging	0.75
R1400:Zfp729b	UTSW	13	67592794	missense	possibly damaging	0.63
R1915:Zfp729b	UTSW	13	67593220	missense	probably damaging	1.00
R1929:Zfp729b	UTSW	13	67592233	missense	probably damaging	1.00
R2229:Zfp729b	UTSW	13	67595265	missense	probably damaging	0.99
R2271:Zfp729b	UTSW	13	67592233	missense	probably damaging	1.00
R2344:Zfp729b	UTSW	13	67592233	missense	probably damaging	1.00
R2377:Zfp729b	UTSW	13	67591701	missense	possibly damaging	0.70
R2930:Zfp729b	UTSW	13	67591854	missense	probably benign
R3053:Zfp729b	UTSW	13	67593466	missense	probably damaging	1.00
R3404:Zfp729b	UTSW	13	67591164	missense	probably damaging	0.98
R4118:Zfp729b	UTSW	13	67592710	missense	possibly damaging	0.91
R4947:Zfp729b	UTSW	13	67596672	missense	probably damaging	1.00
R5408:Zfp729b	UTSW	13	67591444	missense	probably benign	0.18
R5511:Zfp729b	UTSW	13	67592380	missense	probably damaging	1.00
R5542:Zfp729b	UTSW	13	67591021	missense	probably benign
R5908:Zfp729b	UTSW	13	67591255	missense	probably benign	0.00
R5977:Zfp729b	UTSW	13	67591621	missense	probably benign	0.03
R5996:Zfp729b	UTSW	13	67593858	missense	probably benign	0.18
R7086:Zfp729b	UTSW	13	67592937	missense	probably damaging	0.99
R7146:Zfp729b	UTSW	13	67593376	missense	probably damaging	1.00
R7217:Zfp729b	UTSW	13	67595248	missense	probably damaging	0.96
R7332:Zfp729b	UTSW	13	67609636	splice site	probably null
R7472:Zfp729b	UTSW	13	67593883	missense	probably benign	0.00
R7615:Zfp729b	UTSW	13	67591498	missense	possibly damaging	0.77
R7639:Zfp729b	UTSW	13	67591852	missense	probably benign	0.02
R7652:Zfp729b	UTSW	13	67591252	missense	probably benign	0.00
R7738:Zfp729b	UTSW	13	67592075	missense	probably benign	0.00
R8137:Zfp729b	UTSW	13	67592742	missense	probably damaging	1.00
R8381:Zfp729b	UTSW	13	67591498	missense	possibly damaging	0.77
R8402:Zfp729b	UTSW	13	67592577	missense	probably damaging	1.00
R8941:Zfp729b	UTSW	13	67593099	missense	possibly damaging	0.95
R9014:Zfp729b	UTSW	13	67592155	missense	probably damaging	1.00
R9091:Zfp729b	UTSW	13	67592361	missense	probably damaging	1.00
R9168:Zfp729b	UTSW	13	67593823	nonsense	probably null
R9270:Zfp729b	UTSW	13	67592361	missense	probably damaging	1.00
R9390:Zfp729b	UTSW	13	67591063	missense	probably benign	0.00
R9390:Zfp729b	UTSW	13	67593895	missense	possibly damaging	0.95
R9442:Zfp729b	UTSW	13	67591218	missense	probably benign	0.25
X0023:Zfp729b	UTSW	13	67592459	missense	possibly damaging	0.95
X0028:Zfp729b	UTSW	13	67592194	missense	probably damaging	1.00
Z1088:Zfp729b	UTSW	13	67593070	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AATGATGCAATGTGGAAGGCC -3'
(R):5'- TGTTCCATCAAAACTTTCTCATCA -3'

Sequencing Primer
(F):5'- TGGATAATCGAAGGCCTTCC -3'
(R):5'- AAAACCCTACAAGTGTGAAGTATGTG -3'

Posted On

2014-10-16