Incidental Mutation 'R5977:Zfp729b'
ID481212
Institutional Source Beutler Lab
Gene Symbol Zfp729b
Ensembl Gene ENSMUSG00000058093
Gene Namezinc finger protein 729b
SynonymsAA987161
MMRRC Submission 044159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5977 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67589439-67609707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67591621 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 842 (R842C)
Ref Sequence ENSEMBL: ENSMUSP00000012873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably benign
Transcript: ENSMUST00000012873
AA Change: R842C

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: R842C

DomainStartEndE-ValueType
KRAB 5 65 1.63e-28 SMART
ZnF_C2H2 132 154 3.58e-2 SMART
PHD 133 194 1e1 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 188 210 6.78e-3 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
PHD 217 278 7.77e0 SMART
ZnF_C2H2 244 266 6.67e-2 SMART
ZnF_C2H2 272 294 1.12e-3 SMART
ZnF_C2H2 300 322 1.79e-2 SMART
PHD 301 362 1.65e1 SMART
ZnF_C2H2 328 350 2.57e-3 SMART
ZnF_C2H2 356 378 2.43e-4 SMART
ZnF_C2H2 412 434 1.67e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
PHD 441 502 4.46e0 SMART
ZnF_C2H2 468 490 1.58e-3 SMART
ZnF_C2H2 496 518 2.95e-3 SMART
ZnF_C2H2 524 546 4.47e-3 SMART
PHD 525 586 5.77e0 SMART
ZnF_C2H2 552 574 5.42e-2 SMART
ZnF_C2H2 580 602 1.03e-2 SMART
ZnF_C2H2 608 630 5.5e-3 SMART
PHD 609 670 1.52e1 SMART
ZnF_C2H2 636 658 6.99e-5 SMART
ZnF_C2H2 664 686 3.34e-2 SMART
ZnF_C2H2 720 742 3.63e-3 SMART
PHD 721 782 2.67e0 SMART
ZnF_C2H2 748 770 5.42e-2 SMART
ZnF_C2H2 776 798 5.14e-3 SMART
ZnF_C2H2 804 826 4.17e-3 SMART
ZnF_C2H2 832 854 1.47e-3 SMART
PHD 833 894 4.93e0 SMART
ZnF_C2H2 860 882 3.83e-2 SMART
ZnF_C2H2 888 910 4.4e-2 SMART
ZnF_C2H2 916 938 7.78e-3 SMART
ZnF_C2H2 944 966 4.17e-3 SMART
ZnF_C2H2 972 994 1.38e-3 SMART
ZnF_C2H2 1000 1022 1.69e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133177
Predicted Effect probably benign
Transcript: ENSMUST00000138725
SMART Domains Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093

DomainStartEndE-ValueType
KRAB 15 75 1.63e-28 SMART
ZnF_C2H2 142 164 3.58e-2 SMART
ZnF_C2H2 170 192 3.21e-4 SMART
ZnF_C2H2 198 220 6.78e-3 SMART
ZnF_C2H2 226 248 3.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223599
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,615,244 R446S probably damaging Het
2900092C05Rik A T 7: 12,554,737 H159L probably benign Het
4933405O20Rik G A 7: 50,600,090 V291I probably damaging Het
A2ml1 A G 6: 128,581,122 Y24H probably damaging Het
Adgrv1 C T 13: 81,435,559 probably null Het
Ankrd52 C T 10: 128,382,697 H351Y probably damaging Het
Anks6 C A 4: 47,035,748 A588S probably benign Het
Arl15 T G 13: 113,934,109 V80G probably damaging Het
Atp8a1 A G 5: 67,747,285 I532T possibly damaging Het
Birc6 T C 17: 74,603,036 C1475R probably damaging Het
Carmil1 C T 13: 24,069,736 R394Q probably damaging Het
Cbfa2t2 T C 2: 154,517,777 I254T probably damaging Het
Col6a3 A G 1: 90,821,849 V421A possibly damaging Het
Cped1 T C 6: 22,254,608 V1000A probably damaging Het
Cr1l A T 1: 195,114,768 Y282* probably null Het
Cryl1 G T 14: 57,382,779 T43K probably benign Het
Csmd2 C T 4: 128,059,034 P92L probably damaging Het
Ddx60 G A 8: 62,021,410 probably null Het
Dhrs7b C T 11: 60,852,502 R187* probably null Het
Dmtf1 T C 5: 9,140,451 T88A probably damaging Het
Dnah2 T C 11: 69,520,881 E305G possibly damaging Het
Dscaml1 A C 9: 45,721,298 N1154T probably benign Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Egflam T A 15: 7,318,245 Y68F possibly damaging Het
Gcm2 A G 13: 41,103,127 V382A probably damaging Het
Gm18358 A G 7: 85,090,548 noncoding transcript Het
Gm3443 T G 19: 21,557,596 I75S probably benign Het
Gpr182 C A 10: 127,750,879 V68F possibly damaging Het
Herc1 T A 9: 66,433,322 M1651K possibly damaging Het
Hey1 A T 3: 8,666,358 probably null Het
Ighv1-43 A C 12: 114,946,209 V31G probably benign Het
Il17rc T C 6: 113,482,731 V450A probably damaging Het
Kbtbd4 T G 2: 90,906,143 V166G probably benign Het
Marveld2 T C 13: 100,611,689 N294S possibly damaging Het
Mtdh A G 15: 34,099,574 K61E probably damaging Het
Muc5ac T C 7: 141,796,367 S616P possibly damaging Het
Myh15 T C 16: 49,153,503 L1292P probably damaging Het
Nek8 C T 11: 78,167,825 V550M probably benign Het
Nup155 T A 15: 8,130,237 probably null Het
Olfr1356 A T 10: 78,847,738 M59K possibly damaging Het
Olfr1390 G A 11: 49,340,765 V78M probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G A 12: 83,784,369 W1099* probably null Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Prss39 T G 1: 34,502,702 C287G probably damaging Het
Pyroxd2 A G 19: 42,735,472 V338A probably damaging Het
Rab19 T A 6: 39,383,926 F3I probably benign Het
Relt A G 7: 100,863,148 probably benign Het
Sbf2 T A 7: 110,377,986 H647L probably benign Het
Scube1 C T 15: 83,629,488 C327Y probably damaging Het
Sec14l4 A C 11: 4,040,055 Q118P possibly damaging Het
Shisa9 C G 16: 12,267,428 D300E probably benign Het
Smg1 A G 7: 118,141,357 probably benign Het
Sncaip A G 18: 52,869,321 T305A probably benign Het
Sorcs3 T C 19: 48,796,450 V1104A probably damaging Het
Tmem2 A G 19: 21,826,083 T827A probably benign Het
Ugt1a6b C T 1: 88,216,260 R201C probably damaging Het
Unc119b A G 5: 115,130,553 V91A probably benign Het
Uvssa A G 5: 33,389,860 K257E probably damaging Het
Vmn1r199 A C 13: 22,383,246 M237L probably benign Het
Vmn1r69 G A 7: 10,580,490 R26W probably damaging Het
Vmn2r54 A G 7: 12,632,216 F264L probably damaging Het
Vmn2r7 C T 3: 64,716,043 W285* probably null Het
Vmn2r78 T A 7: 86,920,333 S145T possibly damaging Het
Vmn2r78 T A 7: 86,954,907 N764K probably benign Het
Wdr5b T G 16: 36,042,004 H164Q probably damaging Het
Zcchc7 G A 4: 44,894,982 V236I possibly damaging Het
Other mutations in Zfp729b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Zfp729b APN 13 67595230 missense probably benign 0.09
IGL02852:Zfp729b APN 13 67592823 missense probably damaging 0.99
PIT4449001:Zfp729b UTSW 13 67591423 missense probably benign 0.01
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0450:Zfp729b UTSW 13 67591134 missense probably benign
R0510:Zfp729b UTSW 13 67591134 missense probably benign
R1122:Zfp729b UTSW 13 67595284 missense possibly damaging 0.75
R1400:Zfp729b UTSW 13 67592794 missense possibly damaging 0.63
R1915:Zfp729b UTSW 13 67593220 missense probably damaging 1.00
R1929:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2229:Zfp729b UTSW 13 67595265 missense probably damaging 0.99
R2270:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2271:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2344:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2377:Zfp729b UTSW 13 67591701 missense possibly damaging 0.70
R2930:Zfp729b UTSW 13 67591854 missense probably benign
R3053:Zfp729b UTSW 13 67593466 missense probably damaging 1.00
R3404:Zfp729b UTSW 13 67591164 missense probably damaging 0.98
R4118:Zfp729b UTSW 13 67592710 missense possibly damaging 0.91
R4947:Zfp729b UTSW 13 67596672 missense probably damaging 1.00
R5408:Zfp729b UTSW 13 67591444 missense probably benign 0.18
R5511:Zfp729b UTSW 13 67592380 missense probably damaging 1.00
R5542:Zfp729b UTSW 13 67591021 missense probably benign
R5908:Zfp729b UTSW 13 67591255 missense probably benign 0.00
R5996:Zfp729b UTSW 13 67593858 missense probably benign 0.18
R7086:Zfp729b UTSW 13 67592937 missense probably damaging 0.99
R7146:Zfp729b UTSW 13 67593376 missense probably damaging 1.00
R7217:Zfp729b UTSW 13 67595248 missense probably damaging 0.96
R7332:Zfp729b UTSW 13 67609636 utr 5 prime probably null
R7472:Zfp729b UTSW 13 67593883 missense probably benign 0.00
R7615:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R7639:Zfp729b UTSW 13 67591852 missense probably benign 0.02
R7652:Zfp729b UTSW 13 67591252 missense probably benign 0.00
R7738:Zfp729b UTSW 13 67592075 missense probably benign 0.00
X0023:Zfp729b UTSW 13 67592459 missense possibly damaging 0.95
X0028:Zfp729b UTSW 13 67592194 missense probably damaging 1.00
Z1088:Zfp729b UTSW 13 67593070 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGAAGGTCTTGCTACATAAGTC -3'
(R):5'- AAAGCCTACAGTTGTGAGATTTGTGG -3'

Sequencing Primer
(F):5'- GGTCTTGCTACATAAGTCACAATTG -3'
(R):5'- GGAAGGCCTTCGATTATCCATCAAG -3'
Posted On2017-06-26