Incidental Mutation 'R2262:Cass4'
ID243840
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission 040262-MU
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2262 (G1)
Quality Score204
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172427254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 421 (S421P)
Ref Sequence ENSEMBL: ENSMUSP00000154073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably damaging
Transcript: ENSMUST00000099061
AA Change: S419P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570
AA Change: S419P

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: S419P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: S419P

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109136
AA Change: S419P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: S419P

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138288
Predicted Effect probably damaging
Transcript: ENSMUST00000228775
AA Change: S421P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTCATAACGCCCCTAAAGC -3'
(R):5'- CAGATTCCTCTACGTGGTCAGC -3'

Sequencing Primer
(F):5'- CCCTAAAGCCATGCAGGG -3'
(R):5'- GCCCTGCGGATTCTGTG -3'
Posted On2014-10-16