Incidental Mutation 'R2289:Pax8'
ID 244197
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Name paired box 8
Synonyms Pax-8
MMRRC Submission 040288-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2289 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 24420560-24475599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24440740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 227 (D227G)
Ref Sequence ENSEMBL: ENSMUSP00000134343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000136228] [ENSMUST00000149294] [ENSMUST00000153535] [ENSMUST00000153601]
AlphaFold Q00288
Predicted Effect probably benign
Transcript: ENSMUST00000028355
AA Change: D227G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: D227G

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135829
Predicted Effect probably benign
Transcript: ENSMUST00000136228
AA Change: D228G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133316
Gene: ENSMUSG00000026976
AA Change: D228G

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
SCOP:d1fjla_ 221 248 8e-5 SMART
low complexity region 312 329 N/A INTRINSIC
Pfam:Pax2_C 342 404 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149294
AA Change: D227G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976
AA Change: D227G

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153535
SMART Domains Protein: ENSMUSP00000120319
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153601
AA Change: D227G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976
AA Change: D227G

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187034
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,612,261 K1175R possibly damaging Het
Atp12a G A 14: 56,373,262 V288I possibly damaging Het
Cntn6 C T 6: 104,569,028 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcaf10 T A 4: 45,359,816 W244R probably damaging Het
Dixdc1 A G 9: 50,683,872 probably null Het
Dlg4 T A 11: 70,026,926 Y12N probably damaging Het
Fsd1l T A 4: 53,696,931 Y442N possibly damaging Het
Gm156 T C 6: 129,768,177 N152S probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcrt C A 11: 100,761,919 A90S probably damaging Het
Itga6 T A 2: 71,818,529 V119D probably damaging Het
Lman1l T A 9: 57,613,658 E220V possibly damaging Het
Lmtk2 T A 5: 144,176,106 S1215T possibly damaging Het
Loxl2 G A 14: 69,693,075 E763K probably benign Het
Mcrip1 T C 11: 120,544,704 E35G probably damaging Het
Nle1 T A 11: 82,903,053 I386F probably benign Het
Nqo1 T C 8: 107,392,998 I8V probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Phf14 T C 6: 12,047,846 C885R probably damaging Het
Rhobtb3 A C 13: 75,910,927 C251G probably damaging Het
Samd13 C T 3: 146,662,691 A49T probably damaging Het
Snrpa1 T A 7: 66,063,838 V101E probably benign Het
Styx A G 14: 45,354,947 E20G possibly damaging Het
Thoc1 T C 18: 9,984,488 Y325H probably damaging Het
Tmem163 T A 1: 127,495,740 T262S possibly damaging Het
Tsr1 T G 11: 74,899,285 L102R probably damaging Het
Vash1 G C 12: 86,680,178 R64P probably damaging Het
Vps13b A C 15: 35,572,105 D956A probably damaging Het
Vrk1 G A 12: 106,057,861 G199S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp870 A T 17: 32,883,360 S333T probably benign Het
Zranb1 T C 7: 132,950,039 Y140H probably damaging Het
Zscan4b A G 7: 10,901,862 probably null Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24421391 unclassified probably benign
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R5924:Pax8 UTSW 2 24421622 missense probably damaging 0.97
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
R7658:Pax8 UTSW 2 24436511 missense probably benign 0.00
R7660:Pax8 UTSW 2 24436561 missense probably benign
R7690:Pax8 UTSW 2 24441670 missense probably benign 0.37
R7775:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24429597 missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24421555 missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24422971 missense probably damaging 0.99
R8520:Pax8 UTSW 2 24443022 missense probably damaging 1.00
R9651:Pax8 UTSW 2 24441161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGGCTAGAGGACATGC -3'
(R):5'- TCTGAGGCTCCCTTTCACAG -3'

Sequencing Primer
(F):5'- ATGGCTAGAGGACATGCTTTGC -3'
(R):5'- TTTCACAGGAGCATTGGCC -3'
Posted On 2014-10-30