Incidental Mutation 'R2304:Or5w12'
ID 244516
Institutional Source Beutler Lab
Gene Symbol Or5w12
Ensembl Gene ENSMUSG00000075153
Gene Name olfactory receptor family 5 subfamily W member 12
Synonyms GA_x6K02T2Q125-49177531-49176599, MOR177-2, Olfr1135
MMRRC Submission 040303-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2304 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87501777-87502709 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87502238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 158 (I158L)
Ref Sequence ENSEMBL: ENSMUSP00000150079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099853] [ENSMUST00000213835]
AlphaFold Q7TR42
Predicted Effect probably benign
Transcript: ENSMUST00000099853
AA Change: I158L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097439
Gene: ENSMUSG00000075153
AA Change: I158L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-44 PFAM
Pfam:7tm_1 41 290 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213835
AA Change: I158L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,142,366 (GRCm39) R806S probably damaging Het
Ccdc187 T C 2: 26,171,029 (GRCm39) K483R possibly damaging Het
Dcdc5 T A 2: 106,166,488 (GRCm39) noncoding transcript Het
Dvl1 C T 4: 155,940,041 (GRCm39) S391F probably damaging Het
Erg28 A G 12: 85,862,937 (GRCm39) L125P probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm5449 G T 13: 53,679,899 (GRCm39) noncoding transcript Het
Grid2ip T C 5: 143,373,595 (GRCm39) Y796H probably damaging Het
Mcrip1 A T 11: 120,435,519 (GRCm39) F39I probably damaging Het
Prss53 T C 7: 127,487,479 (GRCm39) N291D probably benign Het
Ptpru A T 4: 131,499,879 (GRCm39) V1255D probably damaging Het
Rbl1 T C 2: 156,989,551 (GRCm39) T1023A probably benign Het
Rnaseh2b T C 14: 62,598,838 (GRCm39) S188P probably damaging Het
Sh2d6 T C 6: 72,497,542 (GRCm39) E20G probably damaging Het
Slc13a5 A G 11: 72,149,865 (GRCm39) V172A probably damaging Het
Slco5a1 C T 1: 12,949,486 (GRCm39) G635S probably damaging Het
Sp8 G T 12: 118,812,304 (GRCm39) S53I possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Togaram1 G T 12: 65,023,630 (GRCm39) probably null Het
Trip11 A T 12: 101,865,236 (GRCm39) F146I possibly damaging Het
Vmn1r184 T C 7: 25,966,550 (GRCm39) S99P probably damaging Het
Xpot T C 10: 121,447,488 (GRCm39) I325V probably benign Het
Zfp786 A G 6: 47,797,633 (GRCm39) L435P probably damaging Het
Other mutations in Or5w12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Or5w12 APN 2 87,502,159 (GRCm39) missense probably damaging 0.99
IGL03158:Or5w12 APN 2 87,502,135 (GRCm39) missense probably benign 0.14
R0559:Or5w12 UTSW 2 87,502,244 (GRCm39) missense possibly damaging 0.54
R1288:Or5w12 UTSW 2 87,501,916 (GRCm39) missense probably benign 0.01
R2278:Or5w12 UTSW 2 87,502,289 (GRCm39) missense possibly damaging 0.63
R4328:Or5w12 UTSW 2 87,502,008 (GRCm39) missense possibly damaging 0.52
R5094:Or5w12 UTSW 2 87,502,174 (GRCm39) missense possibly damaging 0.90
R6922:Or5w12 UTSW 2 87,501,797 (GRCm39) nonsense probably null
R7042:Or5w12 UTSW 2 87,501,935 (GRCm39) missense possibly damaging 0.90
R8824:Or5w12 UTSW 2 87,502,304 (GRCm39) missense possibly damaging 0.90
R8919:Or5w12 UTSW 2 87,502,567 (GRCm39) missense probably damaging 1.00
R9142:Or5w12 UTSW 2 87,502,313 (GRCm39) missense probably benign 0.00
R9394:Or5w12 UTSW 2 87,502,094 (GRCm39) missense probably benign 0.01
R9712:Or5w12 UTSW 2 87,502,105 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACAGTAGGAGACCAGGACTC -3'
(R):5'- ACTGCAGTTGGACCAAAGATG -3'

Sequencing Primer
(F):5'- AGGACTCCTGAGATGGTGCTC -3'
(R):5'- TTGGACCAAAGATGCTAGTTGACC -3'
Posted On 2014-10-30