Mutagenetix > Incidental Mutations

Incidental Mutation 'R2304:Xpot'

244530

Institutional Source

Beutler Lab

Gene Symbol

Xpot

Ensembl Gene

ENSMUSG00000034667

Gene Name

exportin, tRNA (nuclear export receptor for tRNAs)

Synonyms

1110004L07Rik, C79645, EXPORTIN-T

MMRRC Submission

040303-MU

Accession Numbers

Genbank: NM_001081056; MGI: 1920442

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R2304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121587380-121626332 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121611583 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 325 (I325V)

Ref Sequence

ENSEMBL: ENSMUSP00000151722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039810] [ENSMUST00000217865] [ENSMUST00000218004]

Predicted Effect

probably benign
Transcript: ENSMUST00000039810
AA Change: I326V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667
AA Change: I326V

Domain	Start	End	E-Value	Type
IBN_N	21	89	1.37e-3	SMART
Pfam:Xpo1	98	248	5.1e-42	PFAM
low complexity region	386	399	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217865

Predicted Effect

probably benign
Transcript: ENSMUST00000218004
AA Change: I325V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	T	A	5: 8,092,366	R806S	probably damaging	Het
Ccdc187	T	C	2: 26,281,017	K483R	possibly damaging	Het
Dcdc5	T	A	2: 106,336,143		noncoding transcript	Het
Dvl1	C	T	4: 155,855,584	S391F	probably damaging	Het
Erg28	A	G	12: 85,816,163	L125P	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm5449	G	T	13: 53,525,863		noncoding transcript	Het
Grid2ip	T	C	5: 143,387,840	Y796H	probably damaging	Het
Mcrip1	A	T	11: 120,544,693	F39I	probably damaging	Het
Olfr1135	T	A	2: 87,671,894	I158L	probably benign	Het
Prss53	T	C	7: 127,888,307	N291D	probably benign	Het
Ptpru	A	T	4: 131,772,568	V1255D	probably damaging	Het
Rbl1	T	C	2: 157,147,631	T1023A	probably benign	Het
Rnaseh2b	T	C	14: 62,361,389	S188P	probably damaging	Het
Sh2d6	T	C	6: 72,520,559	E20G	probably damaging	Het
Slc13a5	A	G	11: 72,259,039	V172A	probably damaging	Het
Slco5a1	C	T	1: 12,879,262	G635S	probably damaging	Het
Sp8	G	T	12: 118,848,569	S53I	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Togaram1	G	T	12: 64,976,856		probably null	Het
Trip11	A	T	12: 101,898,977	F146I	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,125	S99P	probably damaging	Het
Zfp786	A	G	6: 47,820,699	L435P	probably damaging	Het

Other mutations in Xpot

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Xpot	APN	10	121605644	missense	probably benign
IGL01286:Xpot	APN	10	121602338	missense	probably benign	0.03
IGL01364:Xpot	APN	10	121604494	missense	probably benign	0.08
IGL01370:Xpot	APN	10	121604494	missense	probably benign	0.08
IGL01516:Xpot	APN	10	121590222	splice site	probably null
IGL01530:Xpot	APN	10	121611528	missense	probably damaging	0.99
IGL02047:Xpot	APN	10	121601362	unclassified	probably benign
IGL02207:Xpot	APN	10	121613580	missense	probably damaging	1.00
IGL02340:Xpot	APN	10	121615204	missense	probably damaging	1.00
IGL02408:Xpot	APN	10	121603165	missense	probably damaging	1.00
IGL03150:Xpot	APN	10	121609186	missense	probably benign	0.00
IGL03210:Xpot	APN	10	121615227	splice site	probably benign
3-1:Xpot	UTSW	10	121613359	missense	probably benign	0.00
R0077:Xpot	UTSW	10	121605639	missense	probably benign	0.09
R1750:Xpot	UTSW	10	121603027	critical splice donor site	probably null
R1806:Xpot	UTSW	10	121607638	splice site	probably benign
R1950:Xpot	UTSW	10	121619148	missense	probably benign
R2227:Xpot	UTSW	10	121622860	missense	probably damaging	0.98
R3914:Xpot	UTSW	10	121604538	missense	possibly damaging	0.72
R4784:Xpot	UTSW	10	121615063	splice site	probably null
R4884:Xpot	UTSW	10	121606808	missense	probably damaging	1.00
R4904:Xpot	UTSW	10	121617178	missense	probably benign	0.00
R5218:Xpot	UTSW	10	121619138	missense	probably damaging	0.99
R5361:Xpot	UTSW	10	121600860	missense	possibly damaging	0.71
R5651:Xpot	UTSW	10	121604549	missense	probably damaging	0.99
R5894:Xpot	UTSW	10	121613646	missense	probably damaging	1.00
R5915:Xpot	UTSW	10	121615093	missense	probably damaging	0.97
R6139:Xpot	UTSW	10	121611708	missense	probably benign	0.41
R6182:Xpot	UTSW	10	121606258	missense	probably damaging	1.00
R6896:Xpot	UTSW	10	121613485	critical splice donor site	probably null
R7024:Xpot	UTSW	10	121602399	missense	probably benign	0.35
R7146:Xpot	UTSW	10	121606773	missense	probably damaging	1.00
R7272:Xpot	UTSW	10	121617189	critical splice acceptor site	probably null
R7556:Xpot	UTSW	10	121613506	missense	probably benign	0.01
R7882:Xpot	UTSW	10	121619091	critical splice donor site	probably null
R7916:Xpot	UTSW	10	121622943	start gained	probably benign
R8087:Xpot	UTSW	10	121601327	missense	probably benign
R8224:Xpot	UTSW	10	121607608	missense	probably damaging	1.00
R8303:Xpot	UTSW	10	121611500	nonsense	probably null
Z1088:Xpot	UTSW	10	121601323	missense	probably damaging	0.99
Z1176:Xpot	UTSW	10	121617174	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCCAGCCCAAAGTCTGC -3'
(R):5'- AAGGCAGACGGATGTAATCC -3'

Sequencing Primer
(F):5'- AGTCTGCAACTTAATCACTGTTTGTC -3'
(R):5'- ATGTAATCCAGGGCTTTGCTTC -3'

Posted On

2014-10-30