Incidental Mutation 'R2304:Xpot'
ID244530
Institutional Source Beutler Lab
Gene Symbol Xpot
Ensembl Gene ENSMUSG00000034667
Gene Nameexportin, tRNA (nuclear export receptor for tRNAs)
Synonyms1110004L07Rik, C79645, EXPORTIN-T
MMRRC Submission 040303-MU
Accession Numbers

Genbank: NM_001081056; MGI: 1920442

Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2304 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location121587380-121626332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121611583 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 325 (I325V)
Ref Sequence ENSEMBL: ENSMUSP00000151722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039810] [ENSMUST00000217865] [ENSMUST00000218004]
Predicted Effect probably benign
Transcript: ENSMUST00000039810
AA Change: I326V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667
AA Change: I326V

DomainStartEndE-ValueType
IBN_N 21 89 1.37e-3 SMART
Pfam:Xpo1 98 248 5.1e-42 PFAM
low complexity region 386 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217865
Predicted Effect probably benign
Transcript: ENSMUST00000218004
AA Change: I325V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T A 5: 8,092,366 R806S probably damaging Het
Ccdc187 T C 2: 26,281,017 K483R possibly damaging Het
Dcdc5 T A 2: 106,336,143 noncoding transcript Het
Dvl1 C T 4: 155,855,584 S391F probably damaging Het
Erg28 A G 12: 85,816,163 L125P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5449 G T 13: 53,525,863 noncoding transcript Het
Grid2ip T C 5: 143,387,840 Y796H probably damaging Het
Mcrip1 A T 11: 120,544,693 F39I probably damaging Het
Olfr1135 T A 2: 87,671,894 I158L probably benign Het
Prss53 T C 7: 127,888,307 N291D probably benign Het
Ptpru A T 4: 131,772,568 V1255D probably damaging Het
Rbl1 T C 2: 157,147,631 T1023A probably benign Het
Rnaseh2b T C 14: 62,361,389 S188P probably damaging Het
Sh2d6 T C 6: 72,520,559 E20G probably damaging Het
Slc13a5 A G 11: 72,259,039 V172A probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sp8 G T 12: 118,848,569 S53I possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Togaram1 G T 12: 64,976,856 probably null Het
Trip11 A T 12: 101,898,977 F146I possibly damaging Het
Vmn1r184 T C 7: 26,267,125 S99P probably damaging Het
Zfp786 A G 6: 47,820,699 L435P probably damaging Het
Other mutations in Xpot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Xpot APN 10 121605644 missense probably benign
IGL01286:Xpot APN 10 121602338 missense probably benign 0.03
IGL01364:Xpot APN 10 121604494 missense probably benign 0.08
IGL01370:Xpot APN 10 121604494 missense probably benign 0.08
IGL01516:Xpot APN 10 121590222 splice site probably null
IGL01530:Xpot APN 10 121611528 missense probably damaging 0.99
IGL02047:Xpot APN 10 121601362 unclassified probably benign
IGL02207:Xpot APN 10 121613580 missense probably damaging 1.00
IGL02340:Xpot APN 10 121615204 missense probably damaging 1.00
IGL02408:Xpot APN 10 121603165 missense probably damaging 1.00
IGL03150:Xpot APN 10 121609186 missense probably benign 0.00
IGL03210:Xpot APN 10 121615227 splice site probably benign
3-1:Xpot UTSW 10 121613359 missense probably benign 0.00
R0077:Xpot UTSW 10 121605639 missense probably benign 0.09
R1750:Xpot UTSW 10 121603027 critical splice donor site probably null
R1806:Xpot UTSW 10 121607638 splice site probably benign
R1950:Xpot UTSW 10 121619148 missense probably benign
R2227:Xpot UTSW 10 121622860 missense probably damaging 0.98
R3914:Xpot UTSW 10 121604538 missense possibly damaging 0.72
R4784:Xpot UTSW 10 121615063 splice site probably null
R4884:Xpot UTSW 10 121606808 missense probably damaging 1.00
R4904:Xpot UTSW 10 121617178 missense probably benign 0.00
R5218:Xpot UTSW 10 121619138 missense probably damaging 0.99
R5361:Xpot UTSW 10 121600860 missense possibly damaging 0.71
R5651:Xpot UTSW 10 121604549 missense probably damaging 0.99
R5894:Xpot UTSW 10 121613646 missense probably damaging 1.00
R5915:Xpot UTSW 10 121615093 missense probably damaging 0.97
R6139:Xpot UTSW 10 121611708 missense probably benign 0.41
R6182:Xpot UTSW 10 121606258 missense probably damaging 1.00
R6896:Xpot UTSW 10 121613485 critical splice donor site probably null
R7024:Xpot UTSW 10 121602399 missense probably benign 0.35
R7146:Xpot UTSW 10 121606773 missense probably damaging 1.00
R7272:Xpot UTSW 10 121617189 critical splice acceptor site probably null
R7556:Xpot UTSW 10 121613506 missense probably benign 0.01
R7882:Xpot UTSW 10 121619091 critical splice donor site probably null
R7916:Xpot UTSW 10 121622943 start gained probably benign
R8087:Xpot UTSW 10 121601327 missense probably benign
R8224:Xpot UTSW 10 121607608 missense probably damaging 1.00
R8303:Xpot UTSW 10 121611500 nonsense probably null
Z1088:Xpot UTSW 10 121601323 missense probably damaging 0.99
Z1176:Xpot UTSW 10 121617174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCCAGCCCAAAGTCTGC -3'
(R):5'- AAGGCAGACGGATGTAATCC -3'

Sequencing Primer
(F):5'- AGTCTGCAACTTAATCACTGTTTGTC -3'
(R):5'- ATGTAATCCAGGGCTTTGCTTC -3'
Posted On2014-10-30