Incidental Mutation 'R0284:Nsl1'
ID24573
Institutional Source Beutler Lab
Gene Symbol Nsl1
Ensembl Gene ENSMUSG00000062510
Gene NameNSL1, MIS12 kinetochore complex component
SynonymsLOC381318, 4833432M17Rik
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191063012-191086474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191065230 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 97 (E97G)
Ref Sequence ENSEMBL: ENSMUSP00000115289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000076952] [ENSMUST00000078259] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000139340]
Predicted Effect probably benign
Transcript: ENSMUST00000027945
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076952
AA Change: E97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076220
Gene: ENSMUSG00000062510
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 170 1.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078259
AA Change: E97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110893
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139340
AA Change: E97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115289
Gene: ENSMUSG00000062510
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 171 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156527
Meta Mutation Damage Score 0.9373 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Nsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Nsl1 APN 1 191071201 missense probably benign 0.06
IGL03398:Nsl1 APN 1 191082164 splice site probably benign
IGL02988:Nsl1 UTSW 1 191063103 nonsense probably null
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0482:Nsl1 UTSW 1 191063040 start codon destroyed probably null 0.83
R1776:Nsl1 UTSW 1 191063188 missense probably benign
R5187:Nsl1 UTSW 1 191075190 missense probably benign 0.01
R5470:Nsl1 UTSW 1 191080540 missense probably benign 0.24
R5838:Nsl1 UTSW 1 191070113 missense probably benign 0.02
R6133:Nsl1 UTSW 1 191071206 missense probably damaging 0.99
R6636:Nsl1 UTSW 1 191075127 missense probably benign 0.00
R6817:Nsl1 UTSW 1 191063274 critical splice donor site probably null
R7755:Nsl1 UTSW 1 191063183 missense probably benign 0.21
Z1177:Nsl1 UTSW 1 191063231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTCCAGTTCACCAAGAGTCCA -3'
(R):5'- GGGGCCTGTCCATTCTCTGGTA -3'

Sequencing Primer
(F):5'- CGCGTTTGAGTTCTGTGTCA -3'
(R):5'- acaaggggaacaggggg -3'
Posted On2013-04-16