Incidental Mutation 'R0284:Mipol1'
ID 24626
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0284 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57457069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 341 (Q341R)
Ref Sequence ENSEMBL: ENSMUSP00000119918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000123498
AA Change: Q341R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: Q341R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000130447
AA Change: Q341R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: Q341R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000145003
AA Change: Q341R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: Q341R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000153137
AA Change: Q341R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: Q341R

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGGCCTAGTAGCAGAGTTACAG -3'
(R):5'- AGGATTTAAGCACCGCAGAATCCAC -3'

Sequencing Primer
(F):5'- CCTAGTAGCAGAGTTACAGAACAATG -3'
(R):5'- GAATCCACGAGCTGATCCG -3'
Posted On 2013-04-16