Incidental Mutation 'R2398:Mocs1'
ID248618
Institutional Source Beutler Lab
Gene Symbol Mocs1
Ensembl Gene ENSMUSG00000064120
Gene Namemolybdenum cofactor synthesis 1
Synonyms3110045D15Rik
MMRRC Submission 040365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2398 (G1)
Quality Score96
Status Validated
Chromosome17
Chromosomal Location49428362-49455435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49452834 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 381 (I381T)
Ref Sequence ENSEMBL: ENSMUSP00000133694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024797] [ENSMUST00000173033] [ENSMUST00000173362] [ENSMUST00000174647]
Predicted Effect probably damaging
Transcript: ENSMUST00000024797
AA Change: I381T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120
AA Change: I381T

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172871
SMART Domains Protein: ENSMUSP00000134449
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Mob_synth_C 1 86 8.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173033
AA Change: I381T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120
AA Change: I381T

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173430
AA Change: I29T
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Meta Mutation Damage Score 0.2475 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack the cofactor molybdopterin and enzyme activities dependent on the cofactor (including sulfate oxidase and xanthine oxidase), have curly whiskers, and die between postnatal days 1 and 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,860 D160G possibly damaging Het
Akr1c6 T C 13: 4,449,036 S208P probably benign Het
Ap3b2 A G 7: 81,477,195 F269S probably damaging Het
Ap3d1 G A 10: 80,719,172 Q440* probably null Het
Cog2 T C 8: 124,529,926 I137T probably benign Het
Cse1l A G 2: 166,928,997 Y369C probably damaging Het
Dnah9 T C 11: 65,915,203 N3357D probably damaging Het
Fam83b T C 9: 76,502,218 T209A probably damaging Het
Gbp2 G A 3: 142,633,362 A392T probably benign Het
Grsf1 G A 5: 88,673,836 T123I probably damaging Het
Gzmc T A 14: 56,232,771 I90F possibly damaging Het
Hook2 T A 8: 84,991,299 N42K probably damaging Het
Hsp90aa1 T C 12: 110,692,321 M629V possibly damaging Het
Ifna14 T C 4: 88,571,626 D58G possibly damaging Het
Krtap4-8 T C 11: 99,780,277 probably benign Het
Nbas A G 12: 13,432,945 T1408A probably damaging Het
Olfr1057 T A 2: 86,374,839 D191V probably damaging Het
Olfr818 A G 10: 129,945,207 F285S probably benign Het
Orc1 C T 4: 108,601,969 T445I possibly damaging Het
Pdik1l T C 4: 134,278,399 K411E probably benign Het
Pias3 A G 3: 96,703,813 I443V probably benign Het
Psmd2 T C 16: 20,659,472 S536P possibly damaging Het
Rnf10 C T 5: 115,247,273 R554H probably benign Het
Smarcc2 C T 10: 128,469,682 T325I possibly damaging Het
Smchd1 C A 17: 71,360,141 C1752F probably damaging Het
Smchd1 G A 17: 71,426,436 probably benign Het
Svil A G 18: 5,060,613 probably null Het
Tex52 T C 6: 128,379,577 S78P probably damaging Het
Tmem63c T G 12: 87,056,533 V27G probably damaging Het
Ttc41 A G 10: 86,713,386 N148S possibly damaging Het
Vmn2r67 T C 7: 85,136,713 I695V probably damaging Het
Wipf2 T A 11: 98,898,717 probably null Het
Zc3h18 A G 8: 122,413,866 probably benign Het
Zfp804a T A 2: 82,258,669 N947K possibly damaging Het
Zfyve26 T C 12: 79,282,799 probably null Het
Zic2 G T 14: 122,478,917 E422* probably null Het
Zmym4 A T 4: 126,923,136 D4E probably damaging Het
Other mutations in Mocs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mocs1 APN 17 49435264 critical splice donor site probably null
IGL00473:Mocs1 APN 17 49433201 missense probably benign 0.01
IGL01565:Mocs1 APN 17 49452320 missense probably benign 0.00
IGL02822:Mocs1 APN 17 49439569 missense probably damaging 1.00
R0321:Mocs1 UTSW 17 49433258 missense probably damaging 1.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R2155:Mocs1 UTSW 17 49454358 missense probably damaging 1.00
R2271:Mocs1 UTSW 17 49449109 missense probably damaging 1.00
R4669:Mocs1 UTSW 17 49454585 missense possibly damaging 0.67
R5566:Mocs1 UTSW 17 49454183 missense possibly damaging 0.92
R5751:Mocs1 UTSW 17 49449738 unclassified probably null
R6061:Mocs1 UTSW 17 49450313 missense probably damaging 1.00
R6157:Mocs1 UTSW 17 49454736 missense probably benign 0.06
R6212:Mocs1 UTSW 17 49435196 missense probably damaging 1.00
R6268:Mocs1 UTSW 17 49435155 missense probably damaging 1.00
R7047:Mocs1 UTSW 17 49452859 critical splice donor site probably null
R7270:Mocs1 UTSW 17 49449115 missense possibly damaging 0.83
R7395:Mocs1 UTSW 17 49454557 missense possibly damaging 0.56
R7522:Mocs1 UTSW 17 49435264 critical splice donor site probably null
R7872:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
R7955:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGCAATGTACATGAGGG -3'
(R):5'- AGGGGTTCTGCCATTCTATAGTC -3'

Sequencing Primer
(F):5'- CAATGTACATGAGGGGTTTGAC -3'
(R):5'- CTGCCATTCTATAGTCTAAAGGCGAG -3'
Posted On2014-11-11