Mutagenetix > Incidental Mutation

Incidental Mutation 'R2398:Ttc41'

248603

Institutional Source

Beutler Lab

Gene Symbol

Ttc41

Ensembl Gene

ENSMUSG00000044937

Gene Name

tetratricopeptide repeat domain 41

Synonyms

Gnn, BC030307

MMRRC Submission

040365-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R2398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86705811-86776844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86713386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 148 (N148S)

Ref Sequence

ENSEMBL: ENSMUSP00000151920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061458
AA Change: N148S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: N148S

Domain	Start	End	E-Value	Type
low complexity region	216	229	N/A	INTRINSIC
low complexity region	307	315	N/A	INTRINSIC
Blast:AAA	336	401	9e-8	BLAST
SCOP:d1jpna2	338	370	1e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075632
AA Change: N148S

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N148S

Domain	Start	End	E-Value	Type
low complexity region	216	229	N/A	INTRINSIC
low complexity region	307	315	N/A	INTRINSIC
Pfam:NACHT	337	515	5.4e-10	PFAM
SCOP:d1qqea_	805	1028	2e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217747
AA Change: N148S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219108
AA Change: N148S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,860	D160G	possibly damaging	Het
Akr1c6	T	C	13: 4,449,036	S208P	probably benign	Het
Ap3b2	A	G	7: 81,477,195	F269S	probably damaging	Het
Ap3d1	G	A	10: 80,719,172	Q440*	probably null	Het
Cog2	T	C	8: 124,529,926	I137T	probably benign	Het
Cse1l	A	G	2: 166,928,997	Y369C	probably damaging	Het
Dnah9	T	C	11: 65,915,203	N3357D	probably damaging	Het
Fam83b	T	C	9: 76,502,218	T209A	probably damaging	Het
Gbp2	G	A	3: 142,633,362	A392T	probably benign	Het
Grsf1	G	A	5: 88,673,836	T123I	probably damaging	Het
Gzmc	T	A	14: 56,232,771	I90F	possibly damaging	Het
Hook2	T	A	8: 84,991,299	N42K	probably damaging	Het
Hsp90aa1	T	C	12: 110,692,321	M629V	possibly damaging	Het
Ifna14	T	C	4: 88,571,626	D58G	possibly damaging	Het
Krtap4-8	T	C	11: 99,780,277		probably benign	Het
Mocs1	T	C	17: 49,452,834	I381T	probably damaging	Het
Nbas	A	G	12: 13,432,945	T1408A	probably damaging	Het
Olfr1057	T	A	2: 86,374,839	D191V	probably damaging	Het
Olfr818	A	G	10: 129,945,207	F285S	probably benign	Het
Orc1	C	T	4: 108,601,969	T445I	possibly damaging	Het
Pdik1l	T	C	4: 134,278,399	K411E	probably benign	Het
Pias3	A	G	3: 96,703,813	I443V	probably benign	Het
Psmd2	T	C	16: 20,659,472	S536P	possibly damaging	Het
Rnf10	C	T	5: 115,247,273	R554H	probably benign	Het
Smarcc2	C	T	10: 128,469,682	T325I	possibly damaging	Het
Smchd1	C	A	17: 71,360,141	C1752F	probably damaging	Het
Smchd1	G	A	17: 71,426,436		probably benign	Het
Svil	A	G	18: 5,060,613		probably null	Het
Tex52	T	C	6: 128,379,577	S78P	probably damaging	Het
Tmem63c	T	G	12: 87,056,533	V27G	probably damaging	Het
Vmn2r67	T	C	7: 85,136,713	I695V	probably damaging	Het
Wipf2	T	A	11: 98,898,717		probably null	Het
Zc3h18	A	G	8: 122,413,866		probably benign	Het
Zfp804a	T	A	2: 82,258,669	N947K	possibly damaging	Het
Zfyve26	T	C	12: 79,282,799		probably null	Het
Zic2	G	T	14: 122,478,917	E422*	probably null	Het
Zmym4	A	T	4: 126,923,136	D4E	probably damaging	Het

Other mutations in Ttc41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Ttc41	APN	10	86736933	missense	possibly damaging	0.71
IGL01373:Ttc41	APN	10	86775957	missense	possibly damaging	0.61
IGL01636:Ttc41	APN	10	86776678	missense	probably benign
IGL01707:Ttc41	APN	10	86776767	missense	probably damaging	1.00
IGL01814:Ttc41	APN	10	86731026	missense	probably damaging	0.98
IGL01845:Ttc41	APN	10	86776624	missense	probably benign	0.03
IGL01918:Ttc41	APN	10	86713190	missense	probably damaging	1.00
IGL02374:Ttc41	APN	10	86775951	missense	probably damaging	1.00
IGL02489:Ttc41	APN	10	86760914	nonsense	probably null
IGL02887:Ttc41	APN	10	86733654	missense	probably damaging	1.00
IGL03061:Ttc41	APN	10	86736857	missense	possibly damaging	0.65
IGL03077:Ttc41	APN	10	86758348	missense	probably damaging	1.00
IGL03210:Ttc41	APN	10	86724414	critical splice donor site	probably null
IGL03242:Ttc41	APN	10	86776819	makesense	probably null
IGL03307:Ttc41	APN	10	86744440	missense	possibly damaging	0.76
BB003:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
BB013:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R0071:Ttc41	UTSW	10	86736846	missense	probably benign	0.01
R0071:Ttc41	UTSW	10	86736846	missense	probably benign	0.01
R0379:Ttc41	UTSW	10	86712977	missense	possibly damaging	0.65
R0384:Ttc41	UTSW	10	86763947	missense	probably damaging	1.00
R0545:Ttc41	UTSW	10	86759097	missense	probably benign	0.00
R1589:Ttc41	UTSW	10	86776390	missense	probably benign	0.01
R1599:Ttc41	UTSW	10	86776573	missense	probably benign	0.04
R1608:Ttc41	UTSW	10	86775993	missense	probably damaging	1.00
R1670:Ttc41	UTSW	10	86776252	missense	possibly damaging	0.93
R1938:Ttc41	UTSW	10	86776214	missense	probably benign
R2401:Ttc41	UTSW	10	86724374	missense	probably benign	0.42
R3117:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R3119:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R4805:Ttc41	UTSW	10	86729798	missense	possibly damaging	0.62
R4840:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4841:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4842:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4884:Ttc41	UTSW	10	86731018	missense	probably benign	0.00
R4885:Ttc41	UTSW	10	86759102	missense	possibly damaging	0.76
R4898:Ttc41	UTSW	10	86776192	missense	possibly damaging	0.80
R5067:Ttc41	UTSW	10	86744544	missense	probably damaging	0.96
R5253:Ttc41	UTSW	10	86730942	missense	probably benign	0.13
R5268:Ttc41	UTSW	10	86744478	missense	possibly damaging	0.76
R5297:Ttc41	UTSW	10	86776579	missense	probably benign	0.04
R5301:Ttc41	UTSW	10	86719520	missense	probably benign	0.00
R5425:Ttc41	UTSW	10	86776630	missense	probably damaging	0.96
R5567:Ttc41	UTSW	10	86760920	critical splice donor site	probably null
R5635:Ttc41	UTSW	10	86736977	missense	probably benign	0.09
R5752:Ttc41	UTSW	10	86758346	missense	probably benign	0.33
R5868:Ttc41	UTSW	10	86750264	missense	possibly damaging	0.70
R5948:Ttc41	UTSW	10	86713224	missense	probably damaging	1.00
R6116:Ttc41	UTSW	10	86759088	critical splice acceptor site	probably null
R6247:Ttc41	UTSW	10	86776663	missense	probably benign	0.00
R6260:Ttc41	UTSW	10	86731159	missense	probably benign	0.20
R6260:Ttc41	UTSW	10	86733707	missense	probably benign	0.32
R6276:Ttc41	UTSW	10	86744449	missense	probably benign	0.01
R6458:Ttc41	UTSW	10	86758270	missense	possibly damaging	0.45
R7170:Ttc41	UTSW	10	86713503	missense	probably benign	0.17
R7348:Ttc41	UTSW	10	86750348	nonsense	probably null
R7382:Ttc41	UTSW	10	86776510	missense	probably damaging	0.97
R7509:Ttc41	UTSW	10	86713432	missense	probably damaging	1.00
R7689:Ttc41	UTSW	10	86759224	missense	probably damaging	1.00
R7807:Ttc41	UTSW	10	86776631	missense	probably benign	0.02
R7926:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R7998:Ttc41	UTSW	10	86736847	missense	probably benign	0.01
R8021:Ttc41	UTSW	10	86733714	missense	probably benign
R8059:Ttc41	UTSW	10	86712978	missense	probably benign	0.01
R8170:Ttc41	UTSW	10	86776166	missense	probably damaging	1.00
R8303:Ttc41	UTSW	10	86719630	missense	probably benign	0.06
R8375:Ttc41	UTSW	10	86763980	missense	probably damaging	0.97
R8383:Ttc41	UTSW	10	86719526	missense	probably benign	0.00
R8698:Ttc41	UTSW	10	86712977	missense	probably benign	0.00
R8773:Ttc41	UTSW	10	86729815	missense	probably benign	0.35
R8902:Ttc41	UTSW	10	86713001	missense	probably benign	0.06
R8985:Ttc41	UTSW	10	86731092	missense	possibly damaging	0.80
R8988:Ttc41	UTSW	10	86713735	missense	possibly damaging	0.88
R9007:Ttc41	UTSW	10	86733761	missense	probably damaging	1.00
R9137:Ttc41	UTSW	10	86776622	missense	probably benign	0.22
R9236:Ttc41	UTSW	10	86776730	missense	probably damaging	1.00
R9248:Ttc41	UTSW	10	86731249	missense	probably benign	0.00
R9287:Ttc41	UTSW	10	86763966	missense	probably benign	0.43
R9345:Ttc41	UTSW	10	86759225	missense	probably damaging	0.99
R9386:Ttc41	UTSW	10	86713026	missense	probably damaging	0.99
R9500:Ttc41	UTSW	10	86729862	missense	probably benign	0.03
R9570:Ttc41	UTSW	10	86713734	missense	possibly damaging	0.88
R9593:Ttc41	UTSW	10	86713185	missense	probably benign	0.24
X0024:Ttc41	UTSW	10	86724250	missense	probably damaging	1.00
X0064:Ttc41	UTSW	10	86729797	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACACCTGAAACTCTCCCTGG -3'
(R):5'- GCCAATGATCTTAGCCTTGAGC -3'

Sequencing Primer
(F):5'- CTGGACTACGTGAACAGATGCTTC -3'
(R):5'- GCCTTGAGCTTTCCAACCTTCATC -3'

Posted On

2014-11-11