Incidental Mutation 'R2413:Dgki'
ID250059
Institutional Source Beutler Lab
Gene Symbol Dgki
Ensembl Gene ENSMUSG00000038665
Gene Namediacylglycerol kinase, iota
SynonymsC130010K08Rik
MMRRC Submission 040377-MU
Accession Numbers

Genbank: NM_001081206.1

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location36846022-37300184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36847473 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1040 (R1040L)
Ref Sequence ENSEMBL: ENSMUSP00000099071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042075] [ENSMUST00000090314] [ENSMUST00000101532] [ENSMUST00000138286] [ENSMUST00000150300]
Predicted Effect probably benign
Transcript: ENSMUST00000042075
AA Change: R868L

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047858
Gene: ENSMUSG00000038665
AA Change: R868L

DomainStartEndE-ValueType
C1 22 76 3.67e-1 SMART
C1 95 153 5.92e-4 SMART
DAGKc 220 344 6.73e-58 SMART
DAGKa 370 527 2.29e-92 SMART
ANK 792 822 5.53e-3 SMART
ANK 828 857 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090314
AA Change: R1019L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087788
Gene: ENSMUSG00000038665
AA Change: R1019L

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 943 973 5.53e-3 SMART
ANK 979 1008 2.07e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101532
AA Change: R1040L

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099071
Gene: ENSMUSG00000038665
AA Change: R1040L

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 964 994 5.53e-3 SMART
ANK 1000 1029 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138286
SMART Domains Protein: ENSMUSP00000138628
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 1.8e-3 SMART
C1 246 304 2.9e-6 SMART
DAGKc 371 495 3.2e-60 SMART
DAGKa 521 678 1.1e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150300
SMART Domains Protein: ENSMUSP00000138457
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 591 1.43e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are grossly normal and do not develop tumors when wounded or when exposed to phorbol ester. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Dgki
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dgki APN 6 36862456 missense probably benign 0.00
IGL00951:Dgki APN 6 37000159 missense probably damaging 0.97
IGL01087:Dgki APN 6 37012911 missense probably damaging 1.00
IGL01396:Dgki APN 6 37000090 missense probably damaging 1.00
IGL02113:Dgki APN 6 36913625 splice site probably benign
IGL02174:Dgki APN 6 37032921 missense probably damaging 1.00
IGL02215:Dgki APN 6 37016675 missense probably damaging 1.00
IGL02353:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02360:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02662:Dgki APN 6 36862486 splice site probably benign
IGL02891:Dgki APN 6 36913741 missense probably benign 0.15
IGL03040:Dgki APN 6 37149664 splice site probably benign
IGL03064:Dgki APN 6 37149664 splice site probably benign
IGL03283:Dgki APN 6 36937311 splice site probably benign
IGL03349:Dgki APN 6 37097627 critical splice acceptor site probably null
H8477:Dgki UTSW 6 37029851 splice site probably benign
PIT4151001:Dgki UTSW 6 37063981 missense probably benign 0.00
R0392:Dgki UTSW 6 37000178 missense probably damaging 1.00
R0630:Dgki UTSW 6 37000198 missense probably damaging 1.00
R0718:Dgki UTSW 6 37012896 missense probably damaging 1.00
R1420:Dgki UTSW 6 37050269 splice site probably null
R1546:Dgki UTSW 6 37050203 missense probably damaging 1.00
R1634:Dgki UTSW 6 36915490 missense probably benign
R1639:Dgki UTSW 6 36937364 missense probably damaging 1.00
R1738:Dgki UTSW 6 37057432 missense possibly damaging 0.93
R1750:Dgki UTSW 6 36916434 missense probably damaging 0.96
R1808:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R1834:Dgki UTSW 6 37034701 splice site probably benign
R2001:Dgki UTSW 6 36865801 missense possibly damaging 0.94
R2047:Dgki UTSW 6 36913646 missense possibly damaging 0.69
R3034:Dgki UTSW 6 37087670 missense probably damaging 1.00
R4493:Dgki UTSW 6 36974861 intron probably benign
R4684:Dgki UTSW 6 37299846 unclassified probably benign
R4727:Dgki UTSW 6 37299813 unclassified probably benign
R5104:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R5756:Dgki UTSW 6 36937058 intron probably benign
R6946:Dgki UTSW 6 37299636 nonsense probably null
R8357:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8363:Dgki UTSW 6 37016678 missense probably damaging 1.00
R8424:Dgki UTSW 6 36850915 missense probably benign 0.27
R8457:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8791:Dgki UTSW 6 37019940 missense probably damaging 1.00
R8883:Dgki UTSW 6 37016673 missense probably damaging 1.00
X0066:Dgki UTSW 6 37063997 missense probably damaging 1.00
Z1177:Dgki UTSW 6 36975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTTCTTCCAGGGGAGC -3'
(R):5'- AGACTCCATGACTCCTTGTTTACTG -3'

Sequencing Primer
(F):5'- AGGTCTTCATGGCCAATG -3'
(R):5'- GACTCCTTGTTTACTGAGATATACCC -3'
Posted On2014-11-12