Mutagenetix > Incidental Mutations

Incidental Mutation 'R2413:Setd2'

250066

Institutional Source

Beutler Lab

Gene Symbol

Setd2

Ensembl Gene

ENSMUSG00000044791

Gene Name

SET domain containing 2

Synonyms

4921524K10Rik, KMT3A

MMRRC Submission

040377-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R2413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110532597-110618633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110547504 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 129 (E129G)

Ref Sequence

ENSEMBL: ENSMUSP00000116313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153838]

Predicted Effect

probably damaging
Transcript: ENSMUST00000153838
AA Change: E129G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: E129G

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
low complexity region	156	176	N/A	INTRINSIC
low complexity region	185	207	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	392	419	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	867	883	N/A	INTRINSIC
low complexity region	1015	1039	N/A	INTRINSIC
low complexity region	1066	1077	N/A	INTRINSIC
low complexity region	1384	1395	N/A	INTRINSIC
AWS	1468	1523	8.39e-30	SMART
SET	1524	1647	3.07e-41	SMART
PostSET	1648	1664	1.27e-5	SMART
Blast:SET	1689	1714	2e-6	BLAST
low complexity region	1884	1909	N/A	INTRINSIC
low complexity region	1956	1967	N/A	INTRINSIC
coiled coil region	2090	2113	N/A	INTRINSIC
low complexity region	2189	2211	N/A	INTRINSIC
low complexity region	2248	2265	N/A	INTRINSIC
WW	2363	2395	2.1e-11	SMART
Pfam:SRI	2440	2530	6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196814

Predicted Effect

probably benign
Transcript: ENSMUST00000198823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199595

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,309,818	A168S	probably benign	Het
Aspm	A	C	1: 139,477,757	I1461L	probably damaging	Het
Bcas3	C	T	11: 85,531,855	L517F	probably damaging	Het
Brpf3	T	C	17: 28,805,950		probably benign	Het
Cfap74	A	C	4: 155,418,624	R24S	possibly damaging	Het
Clec1a	T	A	6: 129,435,255	S51C	probably damaging	Het
Cyp2c40	G	T	19: 39,803,887	C204*	probably null	Het
Dgki	C	A	6: 36,847,473	R1040L	possibly damaging	Het
F830016B08Rik	T	A	18: 60,300,293	Y149*	probably null	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Frmpd1	A	T	4: 45,278,969	T565S	probably benign	Het
Heatr5b	A	T	17: 78,756,861		probably null	Het
Ipcef1	G	A	10: 6,935,225	P92S	probably damaging	Het
Kctd12	T	A	14: 102,982,167	I92F	probably damaging	Het
Kntc1	C	T	5: 123,764,149	T285I	probably benign	Het
Lipo2	A	T	19: 33,751,257	N32K	probably damaging	Het
Mier3	T	C	13: 111,715,128		probably benign	Het
Myd88	T	C	9: 119,337,418	T277A	probably benign	Het
Myo3a	T	A	2: 22,577,912	Y1331N	probably benign	Het
Neb	C	A	2: 52,210,632	W4422L	probably damaging	Het
Nfasc	A	G	1: 132,595,505	S1019P	probably damaging	Het
Npepps	T	C	11: 97,240,966	E354G	probably damaging	Het
Ntrk2	G	T	13: 58,874,412	R427L	possibly damaging	Het
Olfr578	A	G	7: 102,984,802	S121P	probably damaging	Het
Ptprd	T	A	4: 76,133,200	D262V	probably damaging	Het
Serpina9	C	T	12: 104,001,226		probably null	Het
Slc29a1	A	G	17: 45,585,717	L444P	probably damaging	Het
Synj2	C	A	17: 6,028,574	P217T	probably damaging	Het
Tex52	T	C	6: 128,379,908	L188P	probably damaging	Het
Tmem63a	A	G	1: 180,961,075	M326V	probably benign	Het
Tnxb	A	G	17: 34,718,278	T2900A	probably damaging	Het

Other mutations in Setd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Setd2	APN	9	110551136	missense	possibly damaging	0.94
IGL01023:Setd2	APN	9	110547513	nonsense	probably null
IGL01063:Setd2	APN	9	110573673	missense	probably damaging	1.00
IGL01745:Setd2	APN	9	110594711	missense	probably damaging	0.99
IGL01911:Setd2	APN	9	110617431	splice site	probably null
IGL01955:Setd2	APN	9	110549318	missense	probably benign	0.38
IGL02023:Setd2	APN	9	110594636	missense	probably benign	0.06
IGL02080:Setd2	APN	9	110547450	unclassified	probably null
IGL02412:Setd2	APN	9	110550774	missense	probably benign	0.00
IGL02519:Setd2	APN	9	110553116	missense	probably damaging	0.97
IGL02631:Setd2	APN	9	110550576	missense	possibly damaging	0.80
IGL02754:Setd2	APN	9	110550056	missense	possibly damaging	0.77
IGL02828:Setd2	APN	9	110561214	missense	probably benign	0.31
IGL03033:Setd2	APN	9	110551275	missense	possibly damaging	0.96
IGL03140:Setd2	APN	9	110614952	critical splice donor site	probably null
IGL03378:Setd2	APN	9	110553152	missense	unknown
American_samoa	UTSW	9	110567758	nonsense	probably null
slingshot	UTSW	9	110549507	missense	probably benign	0.00
P0028:Setd2	UTSW	9	110573954	missense	probably benign	0.00
PIT4544001:Setd2	UTSW	9	110551164	missense	probably damaging	1.00
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0167:Setd2	UTSW	9	110573782	missense	probably damaging	1.00
R0408:Setd2	UTSW	9	110594242	missense	probably damaging	1.00
R0452:Setd2	UTSW	9	110553100	splice site	probably null
R0541:Setd2	UTSW	9	110573673	missense	probably damaging	1.00
R0947:Setd2	UTSW	9	110548511	missense	possibly damaging	0.87
R1249:Setd2	UTSW	9	110573880	missense	probably damaging	0.99
R1294:Setd2	UTSW	9	110549507	missense	probably benign	0.00
R1518:Setd2	UTSW	9	110602238	missense	probably damaging	0.98
R1585:Setd2	UTSW	9	110551396	missense	unknown
R1647:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1649:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1651:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1652:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1673:Setd2	UTSW	9	110604180	missense	probably damaging	0.97
R1703:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1706:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1709:Setd2	UTSW	9	110549857	missense	probably benign	0.00
R1752:Setd2	UTSW	9	110594605	missense	probably damaging	1.00
R1796:Setd2	UTSW	9	110550345	missense	probably benign	0.01
R1796:Setd2	UTSW	9	110617816	critical splice acceptor site	probably null
R1812:Setd2	UTSW	9	110550102	missense	probably damaging	0.99
R1884:Setd2	UTSW	9	110556418	critical splice donor site	probably null
R2024:Setd2	UTSW	9	110549133	missense	possibly damaging	0.65
R2051:Setd2	UTSW	9	110550890	missense	probably benign
R2117:Setd2	UTSW	9	110604144	frame shift	probably null
R2120:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2124:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2172:Setd2	UTSW	9	110549844	missense	probably benign	0.10
R2179:Setd2	UTSW	9	110594688	nonsense	probably null
R2262:Setd2	UTSW	9	110561243	intron	probably benign
R2411:Setd2	UTSW	9	110550429	missense	possibly damaging	0.46
R2419:Setd2	UTSW	9	110548997	missense	possibly damaging	0.48
R2424:Setd2	UTSW	9	110617522	missense	probably benign	0.37
R3757:Setd2	UTSW	9	110573685	missense	probably damaging	0.99
R3765:Setd2	UTSW	9	110594246	missense	probably damaging	1.00
R3796:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3797:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3799:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3899:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3900:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3913:Setd2	UTSW	9	110551046	missense	probably damaging	0.99
R4010:Setd2	UTSW	9	110599195	missense	probably null	1.00
R4580:Setd2	UTSW	9	110574243	missense	probably benign	0.06
R4614:Setd2	UTSW	9	110569813	critical splice donor site	probably null
R4651:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4652:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4855:Setd2	UTSW	9	110571954	missense	probably benign	0.02
R4970:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5112:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5123:Setd2	UTSW	9	110617527	missense	possibly damaging	0.76
R5140:Setd2	UTSW	9	110551129	missense	probably benign	0.00
R5202:Setd2	UTSW	9	110551230	missense	probably damaging	1.00
R5290:Setd2	UTSW	9	110617831	missense	probably damaging	1.00
R5560:Setd2	UTSW	9	110549839	nonsense	probably null
R5604:Setd2	UTSW	9	110604216	missense	probably damaging	0.99
R5678:Setd2	UTSW	9	110602186	missense	probably damaging	0.99
R5708:Setd2	UTSW	9	110548823	missense	possibly damaging	0.59
R5763:Setd2	UTSW	9	110556275	splice site	probably null
R5814:Setd2	UTSW	9	110567758	nonsense	probably null
R5924:Setd2	UTSW	9	110574044	missense	probably benign	0.23
R6244:Setd2	UTSW	9	110548665	missense	probably damaging	1.00
R6313:Setd2	UTSW	9	110556366	missense	unknown
R6431:Setd2	UTSW	9	110550385	missense	possibly damaging	0.65
R6526:Setd2	UTSW	9	110532717	missense	probably benign	0.33
R6579:Setd2	UTSW	9	110549778	missense	possibly damaging	0.87
R6996:Setd2	UTSW	9	110550572	missense	probably damaging	0.99
R7012:Setd2	UTSW	9	110547683	missense	probably damaging	0.97
R7105:Setd2	UTSW	9	110548260	missense	probably damaging	1.00
R7134:Setd2	UTSW	9	110548797	missense	possibly damaging	0.87
R7222:Setd2	UTSW	9	110551462	missense
R7359:Setd2	UTSW	9	110562944	missense
R7492:Setd2	UTSW	9	110594632	missense
RF009:Setd2	UTSW	9	110550711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAAAAGGTGTCATTCAGC -3'
(R):5'- ACTGGCTCTGATATCTGTGC -3'

Sequencing Primer
(F):5'- GGTGTCATTCAGCTTCAGTTTTAC -3'
(R):5'- AGATGAAGGTGGTGAGTCTATCATC -3'

Posted On

2014-11-12