Incidental Mutation 'R2413:Brpf3'
ID250075
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Namebromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28801090-28838546 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 28805950 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
Predicted Effect probably benign
Transcript: ENSMUST00000004985
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156029
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 28836700 utr 3 prime probably benign
IGL01397:Brpf3 APN 17 28817632 missense probably benign 0.22
IGL01608:Brpf3 APN 17 28821517 missense probably benign 0.00
IGL02073:Brpf3 APN 17 28807396 missense probably benign
IGL02540:Brpf3 APN 17 28828354 missense probably damaging 1.00
IGL02838:Brpf3 APN 17 28835784 missense probably benign 0.19
IGL02888:Brpf3 APN 17 28828391 missense probably damaging 1.00
IGL02969:Brpf3 APN 17 28821305 missense probably benign 0.05
IGL03036:Brpf3 APN 17 28824048 missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 28835777 missense probably damaging 0.98
R0448:Brpf3 UTSW 17 28806036 missense probably benign 0.10
R0898:Brpf3 UTSW 17 28806990 missense possibly damaging 0.65
R1268:Brpf3 UTSW 17 28836556 missense probably damaging 0.98
R1639:Brpf3 UTSW 17 28824068 critical splice donor site probably null
R1754:Brpf3 UTSW 17 28821323 missense probably benign 0.00
R1867:Brpf3 UTSW 17 28807368 missense probably benign
R1954:Brpf3 UTSW 17 28806559 missense probably benign
R2000:Brpf3 UTSW 17 28821557 missense probably benign 0.20
R2064:Brpf3 UTSW 17 28821364 missense probably benign
R2209:Brpf3 UTSW 17 28828420 missense probably damaging 0.98
R3977:Brpf3 UTSW 17 28807042 missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 28821259 missense probably benign
R4291:Brpf3 UTSW 17 28823975 missense probably benign 0.00
R4369:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4371:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4741:Brpf3 UTSW 17 28817784 missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 28821259 missense probably benign 0.00
R4824:Brpf3 UTSW 17 28806486 missense probably benign
R5360:Brpf3 UTSW 17 28810562 missense probably benign
R5923:Brpf3 UTSW 17 28806636 missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 28810581 missense probably damaging 1.00
R6278:Brpf3 UTSW 17 28821284 missense probably benign 0.00
R6702:Brpf3 UTSW 17 28810659 missense probably benign 0.01
R6884:Brpf3 UTSW 17 28831350 missense probably benign 0.03
R6920:Brpf3 UTSW 17 28823996 missense probably benign 0.34
R6976:Brpf3 UTSW 17 28835777 missense probably damaging 0.98
R7099:Brpf3 UTSW 17 28806637 missense probably benign 0.06
R7108:Brpf3 UTSW 17 28817125 missense probably benign 0.01
R7193:Brpf3 UTSW 17 28836691 makesense probably null
R7316:Brpf3 UTSW 17 28814686 missense probably damaging 1.00
R7326:Brpf3 UTSW 17 28806293 missense probably benign 0.00
R7403:Brpf3 UTSW 17 28821356 missense probably benign
R7666:Brpf3 UTSW 17 28810572 missense possibly damaging 0.83
R7686:Brpf3 UTSW 17 28806934 missense probably damaging 0.98
R7691:Brpf3 UTSW 17 28806831 missense probably damaging 1.00
R8054:Brpf3 UTSW 17 28836597 missense probably damaging 1.00
R8165:Brpf3 UTSW 17 28806274 missense probably benign 0.01
R8200:Brpf3 UTSW 17 28806274 missense probably benign 0.01
R8698:Brpf3 UTSW 17 28818462 missense probably damaging 0.99
R8722:Brpf3 UTSW 17 28810536 missense probably benign 0.42
R8738:Brpf3 UTSW 17 28821240 missense probably benign
Z1177:Brpf3 UTSW 17 28821478 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCGTGTGAATGCTTTAGAG -3'
(R):5'- AAATGCTGATCCGATGTAGGC -3'

Sequencing Primer
(F):5'- TAGAGCAACTGTTCTCAACCTGTGG -3'
(R):5'- ATGTAGGCGGCCATCGATGTC -3'
Posted On2014-11-12