Incidental Mutation 'R2965:Ssrp1'
ID255999
Institutional Source Beutler Lab
Gene Symbol Ssrp1
Ensembl Gene ENSMUSG00000027067
Gene Namestructure specific recognition protein 1
SynonymsHmgi-rs3, T160, Hmgox, Hmg1-rs1
MMRRC Submission 040521-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2965 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85037234-85047109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85041586 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000127058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077798] [ENSMUST00000111613] [ENSMUST00000130729] [ENSMUST00000168266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077798
AA Change: T385A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: T385A

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 1.7e-105 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111613
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127069
Predicted Effect possibly damaging
Transcript: ENSMUST00000130729
AA Change: T385A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: T385A

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 5.7e-106 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146530
Predicted Effect possibly damaging
Transcript: ENSMUST00000168266
AA Change: T385A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: T385A

DomainStartEndE-ValueType
Pfam:SSrecog 75 284 8.8e-91 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
4930430A15Rik A T 2: 111,204,019 S359T possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Aff3 A G 1: 38,209,710 I772T probably damaging Het
Ankar T C 1: 72,675,820 I382V probably benign Het
Anks1 A G 17: 28,053,905 T925A probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Cntln T C 4: 84,974,027 probably null Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Col4a3 T C 1: 82,648,600 L86P unknown Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dnah7b T A 1: 46,207,572 I1636N probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fam187b A C 7: 30,977,729 D221A probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gm10784 A T 13: 49,945,197 noncoding transcript Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gria1 C T 11: 57,185,801 Q8* probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Ice1 A T 13: 70,602,578 D1796E probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Klhl2 C T 8: 64,752,760 V376M probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mycbp2 A G 14: 103,297,358 V304A probably benign Het
Nek10 T C 14: 14,836,202 L141P probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Pkd1l1 T A 11: 8,874,236 S1110C probably damaging Het
Ppp4r4 T C 12: 103,612,821 S873P probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Tcf15 T C 2: 152,143,951 I109T probably damaging Het
Tcp11 C A 17: 28,069,265 D330Y probably benign Het
Tktl2 T A 8: 66,512,063 V91E probably benign Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r228 A G 17: 20,776,347 I303T probably damaging Het
Zfp229 T G 17: 21,746,029 H413Q probably damaging Het
Other mutations in Ssrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ssrp1 APN 2 85041099 splice site probably benign
IGL01935:Ssrp1 APN 2 85046712 makesense probably null
IGL02226:Ssrp1 APN 2 85040361 missense probably damaging 1.00
IGL02793:Ssrp1 APN 2 85040920 missense probably damaging 1.00
IGL02875:Ssrp1 APN 2 85040920 missense probably damaging 1.00
Dickcissel UTSW 2 85041634 missense probably damaging 0.96
Meadowlark UTSW 2 85041106 critical splice acceptor site probably null
PIT4131001:Ssrp1 UTSW 2 85038416 missense probably damaging 1.00
R0313:Ssrp1 UTSW 2 85041554 missense probably damaging 1.00
R0363:Ssrp1 UTSW 2 85040674 missense probably damaging 0.99
R1234:Ssrp1 UTSW 2 85042263 missense probably damaging 1.00
R1643:Ssrp1 UTSW 2 85041185 missense possibly damaging 0.89
R1713:Ssrp1 UTSW 2 85040760 missense probably damaging 0.99
R2049:Ssrp1 UTSW 2 85041427 splice site probably benign
R2113:Ssrp1 UTSW 2 85043006 splice site probably null
R2291:Ssrp1 UTSW 2 85042316 critical splice donor site probably null
R2471:Ssrp1 UTSW 2 85042298 missense possibly damaging 0.95
R3552:Ssrp1 UTSW 2 85044392 missense probably benign
R4060:Ssrp1 UTSW 2 85041634 missense probably damaging 0.96
R4075:Ssrp1 UTSW 2 85045568 missense possibly damaging 0.68
R4131:Ssrp1 UTSW 2 85044447 missense probably null 0.28
R4326:Ssrp1 UTSW 2 85040217 intron probably benign
R4357:Ssrp1 UTSW 2 85041151 missense probably benign 0.22
R4400:Ssrp1 UTSW 2 85037941 missense probably damaging 0.97
R4797:Ssrp1 UTSW 2 85045722 nonsense probably null
R5293:Ssrp1 UTSW 2 85042252 nonsense probably null
R5571:Ssrp1 UTSW 2 85044325 missense probably damaging 0.99
R5592:Ssrp1 UTSW 2 85045519 missense probably benign 0.00
R5743:Ssrp1 UTSW 2 85041168 nonsense probably null
R5991:Ssrp1 UTSW 2 85042296 missense possibly damaging 0.94
R6019:Ssrp1 UTSW 2 85045452 missense probably damaging 1.00
R6133:Ssrp1 UTSW 2 85045339 intron probably benign
R6157:Ssrp1 UTSW 2 85040728 missense probably damaging 0.99
R6225:Ssrp1 UTSW 2 85042814 missense probably benign 0.02
R6551:Ssrp1 UTSW 2 85041106 critical splice acceptor site probably null
R6886:Ssrp1 UTSW 2 85039936 missense probably benign 0.04
R7189:Ssrp1 UTSW 2 85045562 missense probably benign 0.00
R7681:Ssrp1 UTSW 2 85045748 missense probably benign
R7789:Ssrp1 UTSW 2 85041181 missense probably damaging 1.00
X0023:Ssrp1 UTSW 2 85045475 missense probably benign 0.06
Z1088:Ssrp1 UTSW 2 85040653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAAGGCTTCCTGCATCC -3'
(R):5'- TCCCACCATAGAGGAAATGGAG -3'

Sequencing Primer
(F):5'- TGCATCCTCCACCAGGC -3'
(R):5'- CTAAAGCCGGACAGTGGTG -3'
Posted On2014-12-29