Incidental Mutation 'R3108:Zfp229'
ID263682
Institutional Source Beutler Lab
Gene Symbol Zfp229
Ensembl Gene ENSMUSG00000061544
Gene Namezinc finger protein 229
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21730795-21769342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21746816 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 676 (C676S)
Ref Sequence ENSEMBL: ENSMUSP00000138107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065871] [ENSMUST00000182603] [ENSMUST00000182827] [ENSMUST00000183192]
Predicted Effect probably damaging
Transcript: ENSMUST00000065871
AA Change: C676S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065379
Gene: ENSMUSG00000061544
AA Change: C676S

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182603
AA Change: C676S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138107
Gene: ENSMUSG00000061544
AA Change: C676S

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Pfam:zf-C2H2_6 205 219 3.9e-1 PFAM
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182827
SMART Domains Protein: ENSMUSP00000138478
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183192
SMART Domains Protein: ENSMUSP00000138265
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Other mutations in Zfp229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Zfp229 APN 17 21739502 missense possibly damaging 0.52
R0268:Zfp229 UTSW 17 21745841 missense probably benign
R0344:Zfp229 UTSW 17 21745841 missense probably benign
R0608:Zfp229 UTSW 17 21746634 missense probably damaging 1.00
R1672:Zfp229 UTSW 17 21745847 missense probably damaging 1.00
R2215:Zfp229 UTSW 17 21746277 missense possibly damaging 0.90
R2519:Zfp229 UTSW 17 21745587 missense possibly damaging 0.89
R2937:Zfp229 UTSW 17 21745503 missense probably damaging 1.00
R2965:Zfp229 UTSW 17 21746029 missense probably damaging 1.00
R3768:Zfp229 UTSW 17 21745863 missense probably damaging 1.00
R3778:Zfp229 UTSW 17 21745202 missense probably benign 0.44
R3850:Zfp229 UTSW 17 21745862 missense probably damaging 1.00
R4273:Zfp229 UTSW 17 21746821 missense probably benign 0.02
R4731:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4732:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4733:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4818:Zfp229 UTSW 17 21743904 missense probably benign 0.33
R4929:Zfp229 UTSW 17 21746373 missense probably damaging 1.00
R5512:Zfp229 UTSW 17 21745036 splice site probably null
R7124:Zfp229 UTSW 17 21742616 missense probably damaging 0.98
R7511:Zfp229 UTSW 17 21745064 missense probably benign 0.00
R7576:Zfp229 UTSW 17 21745299 missense probably damaging 1.00
R7840:Zfp229 UTSW 17 21746150 nonsense probably null
R8396:Zfp229 UTSW 17 21746096 missense probably damaging 1.00
R8427:Zfp229 UTSW 17 21746834 missense probably damaging 1.00
R8725:Zfp229 UTSW 17 21745847 missense probably damaging 1.00
R8727:Zfp229 UTSW 17 21745847 missense probably damaging 1.00
R8770:Zfp229 UTSW 17 21745814 missense probably damaging 1.00
Z1177:Zfp229 UTSW 17 21743942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAAGGCCTTCTATCAACTATCTC -3'
(R):5'- AGGCCTTCTCAGATTTCCCATG -3'

Sequencing Primer
(F):5'- AGGCCTTCTATCAACTATCTCATCTG -3'
(R):5'- CCCATGTTCATAATGTTTTTCTGGAG -3'
Posted On2015-02-05