Mutagenetix > Incidental Mutation

Incidental Mutation 'R3108:Trhde'

263673

Institutional Source

Beutler Lab

Gene Symbol

Trhde

Ensembl Gene

ENSMUSG00000050663

Gene Name

TRH-degrading enzyme

Synonyms

MMRRC Submission

040582-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R3108 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114398823-114802307 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 114592066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 442 (E442K)

Ref Sequence

ENSEMBL: ENSMUSP00000057449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061632]

AlphaFold

Q8K093

Predicted Effect

probably damaging
Transcript: ENSMUST00000061632
AA Change: E442K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: E442K

Domain	Start	End	E-Value	Type
transmembrane domain	40	62	N/A	INTRINSIC
Pfam:Peptidase_M1	141	531	2.6e-141	PFAM
Pfam:ERAP1_C	679	1004	5.7e-65	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152702

Meta Mutation Damage Score

0.8510

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd2	C	T	7: 79,323,585	S104L	probably benign	Het
Adcy1	A	G	11: 7,169,453	Y1032C	probably damaging	Het
Ap4e1	T	C	2: 127,056,306		probably null	Het
Ccnb1	C	T	13: 100,781,624		probably null	Het
Cfap54	T	C	10: 92,994,683	N1197S	probably benign	Het
Cnot1	A	G	8: 95,735,749	V1691A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dennd4a	A	G	9: 64,912,387	K1760R	probably benign	Het
Drd4	T	A	7: 141,292,282	V82E	possibly damaging	Het
Dtx2	G	A	5: 136,021,816	V323M	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fat1	G	A	8: 45,045,173		probably null	Het
Igkv11-125	T	C	6: 67,913,871	F58L	possibly damaging	Het
Mrgprb1	A	G	7: 48,447,328	S279P	possibly damaging	Het
Muc5b	C	T	7: 141,858,759	T1814M	unknown	Het
Nkpd1	G	A	7: 19,522,978	M227I	probably damaging	Het
Ntrk3	C	T	7: 78,460,515	V324M	probably benign	Het
Nup155	C	A	15: 8,117,306	T210K	probably null	Het
Olfr466	T	C	13: 65,153,061	V279A	possibly damaging	Het
Olfr591	T	A	7: 103,173,086	M184L	probably damaging	Het
Pak4	A	T	7: 28,564,344	Y322*	probably null	Het
Raph1	G	A	1: 60,493,386	A696V	probably benign	Het
Satb1	A	T	17: 51,782,782	Y346N	possibly damaging	Het
Serpina1a	A	T	12: 103,853,841	I382N	probably damaging	Het
Slc34a3	G	T	2: 25,229,245	Q538K	probably benign	Het
Slf1	C	T	13: 77,126,721		probably benign	Het
Ston1	G	T	17: 88,636,155	E330*	probably null	Het
Unc45a	A	G	7: 80,331,546		probably benign	Het
Zfp169	A	G	13: 48,489,996	S552P	possibly damaging	Het
Zfp229	T	A	17: 21,746,816	C676S	probably damaging	Het

Other mutations in Trhde

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Trhde	APN	10	114486747	missense	possibly damaging	0.77
IGL00516:Trhde	APN	10	114446199	missense	probably benign	0.01
IGL01371:Trhde	APN	10	114588500	missense	possibly damaging	0.57
IGL01488:Trhde	APN	10	114446158	missense	possibly damaging	0.58
IGL01602:Trhde	APN	10	114787943	missense	probably benign
IGL01605:Trhde	APN	10	114787943	missense	probably benign
IGL02150:Trhde	APN	10	114592108	missense	probably damaging	1.00
IGL02165:Trhde	APN	10	114592161	missense	probably damaging	1.00
IGL02340:Trhde	APN	10	114592213	splice site	probably benign
IGL02412:Trhde	APN	10	114486925	missense	probably damaging	1.00
IGL02421:Trhde	APN	10	114412461	missense	probably damaging	1.00
IGL02496:Trhde	APN	10	114800561	nonsense	probably null
IGL02952:Trhde	APN	10	114800573	missense	probably damaging	0.99
IGL03197:Trhde	APN	10	114413308	missense	probably benign	0.00
Cata	UTSW	10	114592066	missense	probably damaging	1.00
l3-37	UTSW	10	114801081	missense	probably benign
Pelte	UTSW	10	114486704	critical splice donor site	probably null
G1Funyon:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R0360:Trhde	UTSW	10	114502982	splice site	probably benign
R0364:Trhde	UTSW	10	114502982	splice site	probably benign
R0457:Trhde	UTSW	10	114448262	missense	probably benign	0.37
R0589:Trhde	UTSW	10	114448324	missense	probably benign	0.01
R1132:Trhde	UTSW	10	114412478	missense	possibly damaging	0.86
R1288:Trhde	UTSW	10	114801290	missense	probably benign	0.37
R1569:Trhde	UTSW	10	114446188	missense	possibly damaging	0.78
R1776:Trhde	UTSW	10	114800603	missense	probably benign	0.06
R1781:Trhde	UTSW	10	114588500	missense	possibly damaging	0.57
R1927:Trhde	UTSW	10	114800849	missense	probably damaging	1.00
R1976:Trhde	UTSW	10	114588431	missense	possibly damaging	0.57
R2011:Trhde	UTSW	10	114498793	missense	probably benign	0.02
R2332:Trhde	UTSW	10	114592165	missense	probably damaging	1.00
R2356:Trhde	UTSW	10	114401516	missense	probably damaging	1.00
R3107:Trhde	UTSW	10	114592066	missense	probably damaging	1.00
R3907:Trhde	UTSW	10	114800696	missense	possibly damaging	0.72
R4067:Trhde	UTSW	10	114444680	nonsense	probably null
R4214:Trhde	UTSW	10	114788070	missense	possibly damaging	0.51
R4428:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4429:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R4430:Trhde	UTSW	10	114503123	missense	probably damaging	1.00
R5244:Trhde	UTSW	10	114801081	missense	probably benign
R5456:Trhde	UTSW	10	114486760	missense	possibly damaging	0.58
R5540:Trhde	UTSW	10	114800592	missense	probably benign	0.45
R5699:Trhde	UTSW	10	114588502	missense	probably benign	0.00
R5967:Trhde	UTSW	10	114567134	missense	probably damaging	1.00
R6326:Trhde	UTSW	10	114567224	missense	probably damaging	1.00
R6467:Trhde	UTSW	10	114504198	missense	probably damaging	1.00
R7028:Trhde	UTSW	10	114518177	missense	probably damaging	1.00
R7264:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7266:Trhde	UTSW	10	114800871	missense	possibly damaging	0.93
R7310:Trhde	UTSW	10	114800573	missense	probably damaging	0.99
R7460:Trhde	UTSW	10	114413263	missense	probably damaging	1.00
R7732:Trhde	UTSW	10	114788064	missense	probably benign
R7842:Trhde	UTSW	10	114696098	missense	possibly damaging	0.86
R8178:Trhde	UTSW	10	114408693	missense	possibly damaging	0.93
R8209:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8226:Trhde	UTSW	10	114567228	missense	probably damaging	1.00
R8232:Trhde	UTSW	10	114800537	missense	possibly damaging	0.90
R8301:Trhde	UTSW	10	114487006	missense	probably benign	0.03
R8312:Trhde	UTSW	10	114413287	missense	probably damaging	1.00
R8335:Trhde	UTSW	10	114486704	critical splice donor site	probably null
R8477:Trhde	UTSW	10	114800717	missense	probably benign	0.02
R8853:Trhde	UTSW	10	114800925	missense	probably benign
R8953:Trhde	UTSW	10	114503061	missense	probably damaging	0.98
R9375:Trhde	UTSW	10	114408693	missense	probably damaging	0.99
R9477:Trhde	UTSW	10	114503075	missense	probably benign	0.03
R9486:Trhde	UTSW	10	114696109	missense	possibly damaging	0.89
R9502:Trhde	UTSW	10	114800792	missense	probably damaging	1.00
Z1177:Trhde	UTSW	10	114448389	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCAACCCAGTGACAGTTGCTTAC -3'
(R):5'- GTTGTGAAAATTAGGATCCAGTGTC -3'

Sequencing Primer
(F):5'- GACAGTTGCTTACTCGATACCATCAG -3'
(R):5'- GGATCCAGTGTCTTTAAAAACCTTTG -3'

Posted On

2015-02-05