Incidental Mutation 'R3108:Trhde'
ID263673
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene NameTRH-degrading enzyme
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location114398823-114802307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114592066 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 442 (E442K)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
Predicted Effect probably damaging
Transcript: ENSMUST00000061632
AA Change: E442K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: E442K

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152702
Meta Mutation Damage Score 0.8510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114486747 missense possibly damaging 0.77
IGL00516:Trhde APN 10 114446199 missense probably benign 0.01
IGL01371:Trhde APN 10 114588500 missense possibly damaging 0.57
IGL01488:Trhde APN 10 114446158 missense possibly damaging 0.58
IGL01602:Trhde APN 10 114787943 missense probably benign
IGL01605:Trhde APN 10 114787943 missense probably benign
IGL02150:Trhde APN 10 114592108 missense probably damaging 1.00
IGL02165:Trhde APN 10 114592161 missense probably damaging 1.00
IGL02340:Trhde APN 10 114592213 splice site probably benign
IGL02412:Trhde APN 10 114486925 missense probably damaging 1.00
IGL02421:Trhde APN 10 114412461 missense probably damaging 1.00
IGL02496:Trhde APN 10 114800561 nonsense probably null
IGL02952:Trhde APN 10 114800573 missense probably damaging 0.99
IGL03197:Trhde APN 10 114413308 missense probably benign 0.00
Cata UTSW 10 114592066 missense probably damaging 1.00
l3-37 UTSW 10 114801081 missense probably benign
Pelte UTSW 10 114486704 critical splice donor site probably null
R0360:Trhde UTSW 10 114502982 splice site probably benign
R0364:Trhde UTSW 10 114502982 splice site probably benign
R0457:Trhde UTSW 10 114448262 missense probably benign 0.37
R0589:Trhde UTSW 10 114448324 missense probably benign 0.01
R1132:Trhde UTSW 10 114412478 missense possibly damaging 0.86
R1288:Trhde UTSW 10 114801290 missense probably benign 0.37
R1569:Trhde UTSW 10 114446188 missense possibly damaging 0.78
R1776:Trhde UTSW 10 114800603 missense probably benign 0.06
R1781:Trhde UTSW 10 114588500 missense possibly damaging 0.57
R1927:Trhde UTSW 10 114800849 missense probably damaging 1.00
R1976:Trhde UTSW 10 114588431 missense possibly damaging 0.57
R2011:Trhde UTSW 10 114498793 missense probably benign 0.02
R2332:Trhde UTSW 10 114592165 missense probably damaging 1.00
R2356:Trhde UTSW 10 114401516 missense probably damaging 1.00
R3107:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3907:Trhde UTSW 10 114800696 missense possibly damaging 0.72
R4067:Trhde UTSW 10 114444680 nonsense probably null
R4214:Trhde UTSW 10 114788070 missense possibly damaging 0.51
R4428:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4429:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4430:Trhde UTSW 10 114503123 missense probably damaging 1.00
R5244:Trhde UTSW 10 114801081 missense probably benign
R5456:Trhde UTSW 10 114486760 missense possibly damaging 0.58
R5540:Trhde UTSW 10 114800592 missense probably benign 0.45
R5699:Trhde UTSW 10 114588502 missense probably benign 0.00
R5967:Trhde UTSW 10 114567134 missense probably damaging 1.00
R6326:Trhde UTSW 10 114567224 missense probably damaging 1.00
R6467:Trhde UTSW 10 114504198 missense probably damaging 1.00
R7028:Trhde UTSW 10 114518177 missense probably damaging 1.00
R7264:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7266:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7310:Trhde UTSW 10 114800573 missense probably damaging 0.99
R7460:Trhde UTSW 10 114413263 missense probably damaging 1.00
R7732:Trhde UTSW 10 114788064 missense probably benign
R7842:Trhde UTSW 10 114696098 missense possibly damaging 0.86
R8178:Trhde UTSW 10 114408693 missense possibly damaging 0.93
R8209:Trhde UTSW 10 114567228 missense probably damaging 1.00
R8226:Trhde UTSW 10 114567228 missense probably damaging 1.00
R8232:Trhde UTSW 10 114800537 missense possibly damaging 0.90
R8301:Trhde UTSW 10 114487006 missense probably benign 0.03
R8312:Trhde UTSW 10 114413287 missense probably damaging 1.00
R8335:Trhde UTSW 10 114486704 critical splice donor site probably null
R8477:Trhde UTSW 10 114800717 missense probably benign 0.02
Z1177:Trhde UTSW 10 114448389 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAACCCAGTGACAGTTGCTTAC -3'
(R):5'- GTTGTGAAAATTAGGATCCAGTGTC -3'

Sequencing Primer
(F):5'- GACAGTTGCTTACTCGATACCATCAG -3'
(R):5'- GGATCCAGTGTCTTTAAAAACCTTTG -3'
Posted On2015-02-05