Incidental Mutation 'R3108:Satb1'
ID263683
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Namespecial AT-rich sequence binding protein 1
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location51736187-51833290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51782782 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 346 (Y346N)
Ref Sequence ENSEMBL: ENSMUSP00000134957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129667
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133574
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140979
AA Change: Y346N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144331
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152830
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169480
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176669
AA Change: Y346N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: Y346N

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 51805289 missense probably damaging 1.00
IGL01658:Satb1 APN 17 51775251 missense probably benign 0.33
IGL02070:Satb1 APN 17 51740067 missense probably damaging 0.98
IGL02212:Satb1 APN 17 51775291 missense possibly damaging 0.82
IGL02971:Satb1 APN 17 51742689 missense possibly damaging 0.62
R0049:Satb1 UTSW 17 51740346 missense probably benign 0.28
R0056:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0060:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0113:Satb1 UTSW 17 51782698 nonsense probably null
R0347:Satb1 UTSW 17 51739906 nonsense probably null
R0667:Satb1 UTSW 17 51782861 missense probably damaging 1.00
R1436:Satb1 UTSW 17 51804363 unclassified probably null
R1595:Satb1 UTSW 17 51782701 missense possibly damaging 0.82
R1686:Satb1 UTSW 17 51739999 missense probably benign 0.08
R1921:Satb1 UTSW 17 51742115 nonsense probably null
R1952:Satb1 UTSW 17 51740145 missense probably damaging 1.00
R2012:Satb1 UTSW 17 51782788 nonsense probably null
R2156:Satb1 UTSW 17 51740410 missense probably benign 0.02
R2180:Satb1 UTSW 17 51803496 missense probably damaging 0.96
R2959:Satb1 UTSW 17 51775303 missense possibly damaging 0.91
R3107:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3814:Satb1 UTSW 17 51782907 missense probably damaging 0.98
R4109:Satb1 UTSW 17 51804350 missense probably damaging 0.99
R4727:Satb1 UTSW 17 51804347 missense probably damaging 1.00
R5209:Satb1 UTSW 17 51809207 missense probably benign 0.26
R5652:Satb1 UTSW 17 51742795 missense probably damaging 1.00
R5815:Satb1 UTSW 17 51782953 missense possibly damaging 0.92
R6141:Satb1 UTSW 17 51775376 missense possibly damaging 0.93
R6370:Satb1 UTSW 17 51782797 missense possibly damaging 0.94
R7371:Satb1 UTSW 17 51782980 nonsense probably null
R7409:Satb1 UTSW 17 51809189 missense possibly damaging 0.90
R7471:Satb1 UTSW 17 51783001 missense probably damaging 0.96
R7568:Satb1 UTSW 17 51782724 missense possibly damaging 0.88
R7626:Satb1 UTSW 17 51767967 missense probably benign 0.25
R7749:Satb1 UTSW 17 51767933 missense possibly damaging 0.70
R7863:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
R7946:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
Z1088:Satb1 UTSW 17 51782939 missense probably damaging 0.99
Z1088:Satb1 UTSW 17 51782952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAACACAACTGACCTGAGTTCG -3'
(R):5'- TCCCAGGAAACACAGCTGAG -3'

Sequencing Primer
(F):5'- CTGACCTGAGTTCGGTTAAAAGCC -3'
(R):5'- TGAGCAGCCTCCATCCC -3'
Posted On2015-02-05