Incidental Mutation 'R3108:Dtx2'
ID263656
Institutional Source Beutler Lab
Gene Symbol Dtx2
Ensembl Gene ENSMUSG00000004947
Gene Namedeltex 2, E3 ubiquitin ligase
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3108 (G1)
Quality Score192
Status Validated
Chromosome5
Chromosomal Location135994800-136032872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136021816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 323 (V323M)
Ref Sequence ENSEMBL: ENSMUSP00000005072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827]
Predicted Effect probably benign
Transcript: ENSMUST00000005072
AA Change: V323M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: V323M

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 408 468 2.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111142
AA Change: V323M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: V323M

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 409 469 2.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111144
AA Change: V323M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: V323M

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111145
AA Change: V323M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: V323M

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125827
AA Change: V323M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: V323M

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142041
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Dtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Dtx2 APN 5 136029203 missense possibly damaging 0.95
IGL01536:Dtx2 APN 5 136010086 utr 5 prime probably benign
IGL01584:Dtx2 APN 5 136026566 missense possibly damaging 0.49
IGL01782:Dtx2 APN 5 136010127 nonsense probably null
IGL03091:Dtx2 APN 5 136012374 missense probably damaging 1.00
R0499:Dtx2 UTSW 5 136029103 missense probably damaging 1.00
R0580:Dtx2 UTSW 5 136032326 missense probably damaging 1.00
R1988:Dtx2 UTSW 5 136032293 nonsense probably null
R2062:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2063:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2064:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2065:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2068:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2108:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2110:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2111:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2130:Dtx2 UTSW 5 136012040 missense probably damaging 0.96
R2146:Dtx2 UTSW 5 136030610 missense probably benign 0.21
R3421:Dtx2 UTSW 5 136012478 missense probably damaging 1.00
R4467:Dtx2 UTSW 5 136012076 missense probably damaging 1.00
R4741:Dtx2 UTSW 5 136026517 missense probably benign 0.00
R5083:Dtx2 UTSW 5 136012190 missense probably damaging 1.00
R5318:Dtx2 UTSW 5 136012100 missense possibly damaging 0.92
R5705:Dtx2 UTSW 5 136010295 missense probably damaging 1.00
R5964:Dtx2 UTSW 5 136023699 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACGTGAAACCAGGTTGAAC -3'
(R):5'- GGTTACCGATCACCCCAAAG -3'

Sequencing Primer
(F):5'- GTTGAACACCTTGTCTTCAGAG -3'
(R):5'- GAGGCACTGATCCCCAAG -3'
Posted On2015-02-05