Incidental Mutation 'R3108:Serpina1a'
ID263675
Institutional Source Beutler Lab
Gene Symbol Serpina1a
Ensembl Gene ENSMUSG00000066366
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1A
SynonymsPI1, Aat2, Spi1-1, Aat-2
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103853589-103863562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103853841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 382 (I382N)
Ref Sequence ENSEMBL: ENSMUSP00000072652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072876] [ENSMUST00000085056] [ENSMUST00000124717]
Predicted Effect probably damaging
Transcript: ENSMUST00000072876
AA Change: I382N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072652
Gene: ENSMUSG00000066366
AA Change: I382N

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 1.09e-203 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085056
AA Change: I359N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082132
Gene: ENSMUSG00000066366
AA Change: I359N

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 1.09e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124717
SMART Domains Protein: ENSMUSP00000120398
Gene: ENSMUSG00000066366

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Pfam:Serpin 46 96 2.7e-16 PFAM
Meta Mutation Damage Score 0.8583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Serpina1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Serpina1a APN 12 103854706 missense probably damaging 0.99
IGL02511:Serpina1a APN 12 103855967 nonsense probably null
R0071:Serpina1a UTSW 12 103855743 missense probably benign 0.03
R1610:Serpina1a UTSW 12 103853837 missense possibly damaging 0.69
R1959:Serpina1a UTSW 12 103853800 nonsense probably null
R3107:Serpina1a UTSW 12 103853841 missense probably damaging 1.00
R4303:Serpina1a UTSW 12 103854675 missense probably damaging 1.00
R4814:Serpina1a UTSW 12 103854763 missense probably benign 0.01
R6011:Serpina1a UTSW 12 103857469 missense probably damaging 0.97
R6547:Serpina1a UTSW 12 103855921 missense probably damaging 1.00
R6548:Serpina1a UTSW 12 103853758 missense probably benign 0.00
R6724:Serpina1a UTSW 12 103860420 intron probably benign
R6915:Serpina1a UTSW 12 103853851 missense possibly damaging 0.68
R6991:Serpina1a UTSW 12 103853833 missense probably benign 0.04
R7570:Serpina1a UTSW 12 103853837 missense possibly damaging 0.69
R7629:Serpina1a UTSW 12 103853808 missense probably damaging 1.00
Z1088:Serpina1a UTSW 12 103854667 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCCTGTGTTTAATGGAAGG -3'
(R):5'- TTAAGTGGTCACCGTGAAAGGG -3'

Sequencing Primer
(F):5'- CCTGTGTTTAATGGAAGGAACCC -3'
(R):5'- TCACCGTGAAAGGGGTCTG -3'
Posted On2015-02-05