Incidental Mutation 'R3149:Ift46'
ID264355
Institutional Source Beutler Lab
Gene Symbol Ift46
Ensembl Gene ENSMUSG00000002031
Gene Nameintraflagellar transport 46
Synonyms1500035H01Rik, IFT46
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44767908-44793447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44783748 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000122682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002099] [ENSMUST00000118186] [ENSMUST00000125877] [ENSMUST00000128150] [ENSMUST00000147559] [ENSMUST00000151905]
Predicted Effect probably damaging
Transcript: ENSMUST00000002099
AA Change: D65G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002099
Gene: ENSMUSG00000002031
AA Change: D65G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 60 270 6.2e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118186
AA Change: D65G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113845
Gene: ENSMUSG00000002031
AA Change: D65G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 59 272 1.1e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125877
AA Change: D65G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122682
Gene: ENSMUSG00000002031
AA Change: D65G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 59 113 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143654
Predicted Effect probably benign
Transcript: ENSMUST00000147559
Predicted Effect probably benign
Transcript: ENSMUST00000151905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154090
Predicted Effect probably benign
Transcript: ENSMUST00000214854
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are embryonic lethal at E10.5 and exhibit embryonic growth retardation, neural tube defects, cardiac edema, and randomized heart looping due to absence of cilia at the embryonic node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Ift46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Ift46 APN 9 44786312 missense probably damaging 1.00
IGL02403:Ift46 APN 9 44786879 missense probably damaging 0.96
IGL03355:Ift46 APN 9 44782148 missense possibly damaging 0.67
R4678:Ift46 UTSW 9 44783963 nonsense probably null
R5095:Ift46 UTSW 9 44786849 missense probably damaging 1.00
R5579:Ift46 UTSW 9 44786863 missense possibly damaging 0.87
R7378:Ift46 UTSW 9 44778595 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGTCAAAGCTGCCTTGTAGG -3'
(R):5'- ATCGATCAACTGAGGTGTGTAC -3'

Sequencing Primer
(F):5'- CCTTGTAGGCTACCAGGAAG -3'
(R):5'- CAGTCAGAAAATGTCATTTGACTGGG -3'
Posted On2015-02-05