Incidental Mutation 'R3149:Zswim9'
ID264350
Institutional Source Beutler Lab
Gene Symbol Zswim9
Ensembl Gene ENSMUSG00000070814
Gene Namezinc finger SWIM-type containing 9
Synonyms6330408A02Rik
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13258967-13278721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13277270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 51 (T51A)
Ref Sequence ENSEMBL: ENSMUSP00000104172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558] [ENSMUST00000123025] [ENSMUST00000144470] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]
Predicted Effect probably benign
Transcript: ENSMUST00000098814
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108532
AA Change: T51A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: T51A

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119139
AA Change: T51A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: T51A

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119558
AA Change: T51A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000123025
SMART Domains Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 159 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140530
Predicted Effect probably benign
Transcript: ENSMUST00000144470
Predicted Effect probably benign
Transcript: ENSMUST00000146998
SMART Domains Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
low complexity region 160 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211707
Predicted Effect probably benign
Transcript: ENSMUST00000165964
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177588
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185145
SMART Domains Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
PDB:1X9N|A 247 313 3e-24 PDB
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Other mutations in Zswim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Zswim9 APN 7 13260321 missense possibly damaging 0.53
IGL02063:Zswim9 APN 7 13260681 missense probably damaging 0.98
R0568:Zswim9 UTSW 7 13261026 missense probably damaging 0.99
R0680:Zswim9 UTSW 7 13260321 missense probably benign 0.10
R1438:Zswim9 UTSW 7 13277218 missense possibly damaging 0.86
R1600:Zswim9 UTSW 7 13269571 missense probably damaging 1.00
R1678:Zswim9 UTSW 7 13277411 missense probably benign 0.04
R1745:Zswim9 UTSW 7 13269556 missense probably damaging 1.00
R1938:Zswim9 UTSW 7 13260214 nonsense probably null
R2025:Zswim9 UTSW 7 13269366 missense probably damaging 0.98
R3150:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3176:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3177:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3276:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3277:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3950:Zswim9 UTSW 7 13261577 missense possibly damaging 0.95
R4554:Zswim9 UTSW 7 13277162 missense probably benign 0.33
R4866:Zswim9 UTSW 7 13261169 missense probably damaging 0.99
R4953:Zswim9 UTSW 7 13269558 missense probably damaging 1.00
R5330:Zswim9 UTSW 7 13259985 missense probably damaging 1.00
R5394:Zswim9 UTSW 7 13260983 missense probably damaging 1.00
R5408:Zswim9 UTSW 7 13260826 missense possibly damaging 0.66
R5654:Zswim9 UTSW 7 13261168 missense probably damaging 0.99
R5810:Zswim9 UTSW 7 13260735 missense probably damaging 0.98
R5859:Zswim9 UTSW 7 13261445 missense probably damaging 0.99
R6235:Zswim9 UTSW 7 13261603 missense probably damaging 1.00
R6239:Zswim9 UTSW 7 13261331 nonsense probably null
R6249:Zswim9 UTSW 7 13260977 missense probably damaging 0.98
R6394:Zswim9 UTSW 7 13260963 missense probably damaging 0.99
R7077:Zswim9 UTSW 7 13259752 missense probably damaging 1.00
R7133:Zswim9 UTSW 7 13259737 missense probably damaging 0.98
R7178:Zswim9 UTSW 7 13259997 missense possibly damaging 0.53
R7595:Zswim9 UTSW 7 13261072 missense probably benign 0.21
R8005:Zswim9 UTSW 7 13261138 missense probably damaging 0.98
R8138:Zswim9 UTSW 7 13261411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCAGTGGGCTTCTCTCC -3'
(R):5'- ACTTCTACTCAAGGTCCCAGG -3'

Sequencing Primer
(F):5'- GAAGCTGTTTGGCTCACCC -3'
(R):5'- TCTACTCAAGGTCCCAGGATGGAG -3'
Posted On2015-02-05