Mutagenetix > Incidental Mutations

Incidental Mutation 'R3149:Fam208b'

264369

Institutional Source

Beutler Lab

Gene Symbol

Fam208b

Ensembl Gene

ENSMUSG00000033799

Gene Name

family with sequence similarity 208, member B

Synonyms

BC016423

MMRRC Submission

040601-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R3149 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3566035-3611108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3574359 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1182 (P1182S)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096069]

Predicted Effect

probably benign
Transcript: ENSMUST00000096069
AA Change: P1864S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: P1864S

Domain	Start	End	E-Value	Type
Pfam:DUF3699	91	167	1.4e-24	PFAM
low complexity region	272	282	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
Pfam:DUF3715	533	695	2.3e-25	PFAM
low complexity region	1156	1168	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	2012	2021	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222615

Predicted Effect

probably damaging
Transcript: ENSMUST00000222909
AA Change: P1182S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	G	A	17: 56,876,348	A30T	probably benign	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Cel	T	C	2: 28,556,131	D576G	probably benign	Het
Csf2ra	C	A	19: 61,227,320	A16S	possibly damaging	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dus1l	T	C	11: 120,793,104	T173A	possibly damaging	Het
Dzip1	T	C	14: 118,911,368	T300A	probably benign	Het
Ggta1	A	T	2: 35,402,623	I224N	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5150	A	G	3: 16,006,315	L3P	probably damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7137	T	C	10: 77,788,005		probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hoxa13	G	T	6: 52,260,304		probably benign	Het
Ift46	A	G	9: 44,783,748	D65G	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Mapk11	T	C	15: 89,145,450		probably null	Het
Mettl25	T	C	10: 105,826,353	D252G	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr479	C	T	7: 108,055,782	R267C	probably benign	Het
Pecam1	A	G	11: 106,684,281	V601A	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rassf9	A	T	10: 102,544,826	D21V	possibly damaging	Het
Rmnd5a	T	A	6: 71,429,101	I68L	probably benign	Het
Rock2	T	C	12: 16,965,091	S762P	probably damaging	Het
Srgap2	T	C	1: 131,292,589	T216A	probably benign	Het
Vmn1r86	T	A	7: 13,102,431	K123*	probably null	Het
Vmn2r68	A	C	7: 85,237,667	V13G	probably benign	Het
Vps13d	G	C	4: 145,126,577	N2322K	possibly damaging	Het
Xpo5	A	G	17: 46,242,247		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Fam208b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Fam208b	APN	13	3574832	missense	probably benign
IGL00670:Fam208b	APN	13	3585241	missense	probably benign	0.14
IGL00957:Fam208b	APN	13	3577101	missense	possibly damaging	0.86
IGL01311:Fam208b	APN	13	3575885	missense	possibly damaging	0.85
IGL01318:Fam208b	APN	13	3575067	missense	possibly damaging	0.66
IGL01767:Fam208b	APN	13	3576633	missense	probably benign	0.00
IGL02073:Fam208b	APN	13	3574721	missense	probably benign	0.01
IGL02152:Fam208b	APN	13	3585371	missense	probably benign
IGL02431:Fam208b	APN	13	3574736	missense	possibly damaging	0.85
IGL02478:Fam208b	APN	13	3574661	missense	probably benign	0.12
IGL02732:Fam208b	APN	13	3573626	missense	probably benign	0.09
IGL02745:Fam208b	APN	13	3585140	missense	probably benign	0.23
IGL02800:Fam208b	APN	13	3585154	missense	probably benign
IGL02989:Fam208b	APN	13	3584820	missense	probably benign	0.01
IGL03124:Fam208b	APN	13	3574704	missense	probably benign	0.41
IGL03154:Fam208b	APN	13	3575255	missense	possibly damaging	0.56
IGL03216:Fam208b	APN	13	3574553	missense	probably damaging	0.98
H8562:Fam208b	UTSW	13	3577000	missense	probably damaging	0.98
PIT4585001:Fam208b	UTSW	13	3574979	missense	possibly damaging	0.55
R0016:Fam208b	UTSW	13	3585170	unclassified	probably null
R0016:Fam208b	UTSW	13	3585170	unclassified	probably null
R0157:Fam208b	UTSW	13	3575550	missense	probably benign	0.06
R0375:Fam208b	UTSW	13	3596842	missense	possibly damaging	0.85
R0403:Fam208b	UTSW	13	3582052	nonsense	probably null
R0472:Fam208b	UTSW	13	3588364	missense	possibly damaging	0.93
R0517:Fam208b	UTSW	13	3566964	missense	possibly damaging	0.94
R0586:Fam208b	UTSW	13	3590321	missense	probably damaging	0.99
R0600:Fam208b	UTSW	13	3576054	missense	probably benign
R0659:Fam208b	UTSW	13	3574448	missense	probably damaging	0.99
R1257:Fam208b	UTSW	13	3575049	missense	probably benign	0.25
R1375:Fam208b	UTSW	13	3576029	missense	probably benign	0.06
R1443:Fam208b	UTSW	13	3575543	missense	probably benign	0.00
R1497:Fam208b	UTSW	13	3570409	missense	probably damaging	0.96
R1544:Fam208b	UTSW	13	3590413	missense	possibly damaging	0.68
R1554:Fam208b	UTSW	13	3576374	missense	possibly damaging	0.85
R1629:Fam208b	UTSW	13	3574121	missense	possibly damaging	0.84
R1633:Fam208b	UTSW	13	3581771	missense	possibly damaging	0.53
R1661:Fam208b	UTSW	13	3573860	missense	possibly damaging	0.63
R1673:Fam208b	UTSW	13	3584498	critical splice donor site	probably null
R1675:Fam208b	UTSW	13	3569507	missense	possibly damaging	0.65
R1781:Fam208b	UTSW	13	3584759	missense	possibly damaging	0.95
R1792:Fam208b	UTSW	13	3590559	missense	possibly damaging	0.91
R1826:Fam208b	UTSW	13	3581759	missense	probably damaging	0.98
R1920:Fam208b	UTSW	13	3576612	missense	possibly damaging	0.63
R1983:Fam208b	UTSW	13	3574853	missense	possibly damaging	0.92
R2016:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2017:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2220:Fam208b	UTSW	13	3581872	missense	probably benign	0.00
R2513:Fam208b	UTSW	13	3582150	missense	possibly damaging	0.53
R2898:Fam208b	UTSW	13	3585122	missense	possibly damaging	0.82
R2904:Fam208b	UTSW	13	3582185	missense	possibly damaging	0.53
R3623:Fam208b	UTSW	13	3595556	missense	probably benign
R3624:Fam208b	UTSW	13	3595556	missense	probably benign
R3725:Fam208b	UTSW	13	3590538	missense	probably benign	0.33
R3835:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R3890:Fam208b	UTSW	13	3596785	missense	probably damaging	0.96
R4023:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4024:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4025:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4050:Fam208b	UTSW	13	3573507	missense	probably benign	0.09
R4308:Fam208b	UTSW	13	3569498	missense	probably damaging	0.97
R4484:Fam208b	UTSW	13	3581831	missense	probably benign	0.12
R4674:Fam208b	UTSW	13	3573686	missense	possibly damaging	0.69
R4718:Fam208b	UTSW	13	3574495	missense	probably benign	0.00
R4745:Fam208b	UTSW	13	3590069	missense	probably benign	0.26
R4776:Fam208b	UTSW	13	3570391	missense	probably damaging	1.00
R4839:Fam208b	UTSW	13	3584807	missense	probably damaging	0.96
R4855:Fam208b	UTSW	13	3566680	splice site	probably null
R5049:Fam208b	UTSW	13	3574000	missense	probably benign	0.00
R5076:Fam208b	UTSW	13	3576357	missense	probably benign	0.41
R5287:Fam208b	UTSW	13	3575744	missense	probably benign	0.41
R5298:Fam208b	UTSW	13	3595613	splice site	probably null
R5379:Fam208b	UTSW	13	3588496	missense	probably benign	0.41
R5512:Fam208b	UTSW	13	3595517	missense	probably damaging	0.99
R5624:Fam208b	UTSW	13	3584996	missense	possibly damaging	0.66
R5750:Fam208b	UTSW	13	3573642	nonsense	probably null
R6114:Fam208b	UTSW	13	3590081	missense	probably damaging	1.00
R6118:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6119:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6269:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6270:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6271:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6272:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6525:Fam208b	UTSW	13	3576540	nonsense	probably null
R6550:Fam208b	UTSW	13	3590519	missense	possibly damaging	0.85
R6714:Fam208b	UTSW	13	3594189	missense	probably benign	0.00
R6797:Fam208b	UTSW	13	3576769	missense	probably benign	0.26
R6967:Fam208b	UTSW	13	3574819	missense	probably benign	0.22
R7016:Fam208b	UTSW	13	3576857	missense	possibly damaging	0.92
R7219:Fam208b	UTSW	13	3590521	missense	probably damaging	0.99
R7454:Fam208b	UTSW	13	3585332	missense	probably benign	0.21
R7570:Fam208b	UTSW	13	3573621	missense	probably damaging	0.99
R7571:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R7580:Fam208b	UTSW	13	3574752	missense	probably damaging	0.99
R7587:Fam208b	UTSW	13	3568849	missense	possibly damaging	0.83
R7657:Fam208b	UTSW	13	3573777	missense	probably damaging	0.98
R7810:Fam208b	UTSW	13	3575714	missense	possibly damaging	0.61
X0024:Fam208b	UTSW	13	3599837	missense	probably null	0.99
X0025:Fam208b	UTSW	13	3576827	missense	probably benign	0.15
X0066:Fam208b	UTSW	13	3588441	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATGCCAGGTACTAGTCCAGGAG -3'
(R):5'- ACGTTCTGGAGCCTATGTTCAG -3'

Sequencing Primer
(F):5'- GGTACTAGTCCAGGAGCTGAG -3'
(R):5'- AGCCTATGTTCAGGATTCTCATG -3'

Posted On

2015-02-05