Incidental Mutation 'RF034:Rprd2'
ID 604480
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Name regulation of nuclear pre-mRNA domain containing 2
Synonyms 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock # RF034 (G1)
Quality Score 214.459
Status Not validated
Chromosome 3
Chromosomal Location 95760341-95818863 bp(-) (GRCm38)
Type of Mutation small deletion (7 aa in frame mutation)
DNA Base Change (assembly) AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC to AGAGGCTGTGGTGCTC at 95766320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
AlphaFold Q6NXI6
Predicted Effect probably benign
Transcript: ENSMUST00000090791
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200164
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95765224 missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95764089 missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95766087 missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95765775 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95776793 missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95764055 missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95780584 missense probably damaging 0.99
R9030:Rprd2 UTSW 3 95784310 missense probably benign 0.15
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGTAAATCCCAAAGAACTGGATG -3'
(R):5'- GCGCTGCCTGTTTAGTCTAG -3'

Sequencing Primer
(F):5'- AACTGGATGGTAGTTTAAACGTAGTG -3'
(R):5'- TTAAAGTCTATCCCACCAGAGTG -3'
Posted On 2019-12-04