Incidental Mutation 'R3081:Vps13a'
ID265464
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 040571-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16664737 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2175 (N2175K)
Ref Sequence ENSEMBL: ENSMUSP00000153129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect probably benign
Transcript: ENSMUST00000068156
AA Change: N2175K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: N2175K

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223897
Predicted Effect probably benign
Transcript: ENSMUST00000224149
AA Change: N2175K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224725
Predicted Effect probably benign
Transcript: ENSMUST00000225233
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 intron probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 intron probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCGATGCTAACCCTTTAACCTC -3'
(R):5'- CAGGGCATTGAGAACACTGTTG -3'

Sequencing Primer
(F):5'- CTGAAAGGAAAAGAGAACTGGTTTTG -3'
(R):5'- GGCATTGAGAACACTGTTGTTACTC -3'
Posted On2015-02-05