Incidental Mutation 'R3024:Sstr3'
List |< first << previous [record 18 of 23] next >> last >|
ID265781
Institutional Source Beutler Lab
Gene Symbol Sstr3
Ensembl Gene ENSMUSG00000044933
Gene Namesomatostatin receptor 3
Synonymssst3, Smstr-3, Smstr3
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3024 (G1)
Quality Score203
Status Not validated
Chromosome15
Chromosomal Location78537008-78544685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78539987 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 187 (R187W)
Ref Sequence ENSEMBL: ENSMUSP00000058040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]
Predicted Effect probably damaging
Transcript: ENSMUST00000053239
AA Change: R187W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: R187W

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 291 1.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 337 3.5e-15 PFAM
Pfam:7tm_1 62 322 6.3e-60 PFAM
Pfam:7TM_GPCR_Srv 121 337 9.5e-8 PFAM
coiled coil region 355 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230400
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Sstr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sstr3 APN 15 78540467 missense probably benign 0.00
R0442:Sstr3 UTSW 15 78540397 missense probably damaging 0.99
R1714:Sstr3 UTSW 15 78540273 missense probably damaging 1.00
R1865:Sstr3 UTSW 15 78539968 missense probably damaging 1.00
R2008:Sstr3 UTSW 15 78540511 missense probably benign 0.14
R2351:Sstr3 UTSW 15 78539921 missense probably benign 0.01
R3023:Sstr3 UTSW 15 78539987 missense probably damaging 0.99
R3770:Sstr3 UTSW 15 78540377 missense probably damaging 1.00
R4399:Sstr3 UTSW 15 78540124 missense probably damaging 1.00
R4724:Sstr3 UTSW 15 78539697 nonsense probably null
R6181:Sstr3 UTSW 15 78539461 missense probably benign
R6247:Sstr3 UTSW 15 78539588 missense probably damaging 0.99
R7450:Sstr3 UTSW 15 78539843 missense probably damaging 1.00
R7578:Sstr3 UTSW 15 78540517 missense probably benign
R7793:Sstr3 UTSW 15 78540388 missense probably damaging 1.00
X0026:Sstr3 UTSW 15 78539374 missense possibly damaging 0.57
Z1177:Sstr3 UTSW 15 78539303 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCAGATAGAAAGGCATCC -3'
(R):5'- TGGCATCAACCAGTTCACCAG -3'

Sequencing Primer
(F):5'- TGTACCCACTGACACGAGG -3'
(R):5'- AACCAGTTCACCAGCATCTTCTG -3'
Posted On2015-02-05