Incidental Mutation 'R3693:Strn'
ID268878
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78656992 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 515 (N515D)
Ref Sequence ENSEMBL: ENSMUSP00000024881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
Predicted Effect probably damaging
Transcript: ENSMUST00000024881
AA Change: N515D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077
AA Change: N515D

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145910
AA Change: N668D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077
AA Change: N668D

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Meta Mutation Damage Score 0.6009 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF036:Strn UTSW 17 78677277 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF044:Strn UTSW 17 78677288 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677270 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTACTCCGTGACCGTG -3'
(R):5'- TCGTGGTTTAGCTCAGGTAAC -3'

Sequencing Primer
(F):5'- CCACAACTAGCTTGCTTTTAGTAGG -3'
(R):5'- ACTGCAGCCAGACTAAAG -3'
Posted On2015-02-19