Incidental Mutation 'R3737:Nolc1'
ID 270209
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Name nucleolar and coiled-body phosphoprotein 1
Synonyms 3230402K17Rik, P130, NOPP140
MMRRC Submission 040724-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3737 (G1)
Quality Score 115
Status Not validated
Chromosome 19
Chromosomal Location 46064302-46073969 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) C to CAGT at 46069816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
AlphaFold E9Q5C9
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Api5 C T 2: 94,255,958 (GRCm39) R243Q possibly damaging Het
Arap1 A T 7: 101,049,484 (GRCm39) Y982F possibly damaging Het
Bicral A T 17: 47,136,836 (GRCm39) Y125N probably damaging Het
Brd2 A G 17: 34,336,054 (GRCm39) L53S probably benign Het
Ccdc88c G A 12: 100,896,783 (GRCm39) A1389V possibly damaging Het
Cdk17 G A 10: 93,057,506 (GRCm39) probably null Het
Clca3a1 A G 3: 144,436,482 (GRCm39) V867A probably benign Het
Dchs1 T A 7: 105,411,523 (GRCm39) D1531V possibly damaging Het
Dnah9 G A 11: 66,047,734 (GRCm39) Q29* probably null Het
Dop1a T C 9: 86,376,486 (GRCm39) V240A probably damaging Het
Fgfbp1 T C 5: 44,136,938 (GRCm39) Y118C probably damaging Het
Gal3st2c A G 1: 93,937,050 (GRCm39) I332V possibly damaging Het
Gprc6a A C 10: 51,503,007 (GRCm39) N285K probably benign Het
Hcn4 A G 9: 58,751,172 (GRCm39) D266G probably benign Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Hmgcr C G 13: 96,787,571 (GRCm39) L852F probably damaging Het
Ifi203 T A 1: 173,757,040 (GRCm39) probably benign Het
Il36rn T C 2: 24,171,215 (GRCm39) F101S probably damaging Het
Isl2 A G 9: 55,449,754 (GRCm39) S119G probably benign Het
Kctd9 G A 14: 67,971,737 (GRCm39) D157N possibly damaging Het
Lcorl A T 5: 45,891,383 (GRCm39) N323K possibly damaging Het
Ltbp2 A T 12: 84,851,248 (GRCm39) C836S probably damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Mon2 A G 10: 122,849,280 (GRCm39) L1340P probably damaging Het
Myh9 G A 15: 77,651,012 (GRCm39) R1612C probably damaging Het
Nlrp4f T C 13: 65,341,821 (GRCm39) N608S probably benign Het
Or8b4 G A 9: 37,829,937 (GRCm39) probably benign Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Pcm1 T A 8: 41,714,080 (GRCm39) Y215* probably null Het
Pde6c T A 19: 38,128,672 (GRCm39) V212D probably damaging Het
Ppl T C 16: 4,924,721 (GRCm39) T115A probably benign Het
Prtg G T 9: 72,749,991 (GRCm39) E132* probably null Het
R3hcc1 C T 14: 69,935,042 (GRCm39) R262Q probably benign Het
Serpinb6d T A 13: 33,851,663 (GRCm39) V140E probably damaging Het
Ska3 A T 14: 58,049,053 (GRCm39) M306K probably benign Het
Spesp1 T A 9: 62,180,318 (GRCm39) I197L probably benign Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Tprg1l T C 4: 154,244,585 (GRCm39) I137V probably benign Het
Ttk C A 9: 83,736,890 (GRCm39) P450T possibly damaging Het
Ube2j1 A T 4: 33,036,723 (GRCm39) M16L probably benign Het
Ubr3 G A 2: 69,801,578 (GRCm39) probably null Het
Usp42 C T 5: 143,701,194 (GRCm39) S943N probably benign Het
Usp49 G A 17: 47,983,243 (GRCm39) V83M probably damaging Het
Usp6nl C A 2: 6,445,728 (GRCm39) N568K probably damaging Het
Utp20 C T 10: 88,598,668 (GRCm39) V103I probably benign Het
Vmn1r55 T G 7: 5,150,195 (GRCm39) D76A probably damaging Het
Xrcc6 T C 15: 81,913,832 (GRCm39) Y53H probably damaging Het
Zbtb7c T G 18: 76,270,011 (GRCm39) L33R probably damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46,071,468 (GRCm39) unclassified probably benign
FR4976:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
FR4976:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R0106:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R0121:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0140:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0501:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46,072,598 (GRCm39) missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R1553:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
R1642:Nolc1 UTSW 19 46,067,461 (GRCm39) critical splice donor site probably null
R1698:Nolc1 UTSW 19 46,069,870 (GRCm39) splice site probably null
R2067:Nolc1 UTSW 19 46,072,046 (GRCm39) missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46,069,800 (GRCm39) small insertion probably benign
R2113:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,807 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2895:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R2999:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R3737:Nolc1 UTSW 19 46,069,809 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,792 (GRCm39) small insertion probably benign
R3747:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R3806:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
R4035:Nolc1 UTSW 19 46,069,797 (GRCm39) small insertion probably benign
R4619:Nolc1 UTSW 19 46,071,959 (GRCm39) missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R4999:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46,070,103 (GRCm39) nonsense probably null
R5559:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R5837:Nolc1 UTSW 19 46,071,622 (GRCm39) unclassified probably benign
R6457:Nolc1 UTSW 19 46,071,509 (GRCm39) unclassified probably benign
R7467:Nolc1 UTSW 19 46,070,773 (GRCm39) missense unknown
R7497:Nolc1 UTSW 19 46,071,257 (GRCm39) missense probably benign 0.23
R8011:Nolc1 UTSW 19 46,070,023 (GRCm39) missense unknown
R8806:Nolc1 UTSW 19 46,071,471 (GRCm39) missense unknown
RF027:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF031:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF034:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF040:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF044:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
X0050:Nolc1 UTSW 19 46,069,791 (GRCm39) small deletion probably benign
Y5377:Nolc1 UTSW 19 46,069,808 (GRCm39) small insertion probably benign
Y5379:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
Z1088:Nolc1 UTSW 19 46,071,537 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATCTAGGCATCTCACTCAGGTC -3'
(R):5'- TGGTACAGTCTTCATTGGAGAG -3'

Sequencing Primer
(F):5'- AGGTCATCCTTTACCTGCTAAG -3'
(R):5'- GAAAATTAACATTAGAGGAAAGCGCC -3'
Posted On 2015-03-18