Incidental Mutation 'R3783:Tekt1'
ID272129
Institutional Source Beutler Lab
Gene Symbol Tekt1
Ensembl Gene ENSMUSG00000020799
Gene Nametektin 1
SynonymsMT14
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72344722-72362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72344894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 376 (I376T)
Ref Sequence ENSEMBL: ENSMUSP00000104143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021155] [ENSMUST00000108502] [ENSMUST00000108503]
Predicted Effect probably damaging
Transcript: ENSMUST00000021155
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021155
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 398 1.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108502
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104142
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108503
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104143
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158122
Meta Mutation Damage Score 0.5797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Tekt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Tekt1 UTSW 11 72354834 missense probably damaging 1.00
R0463:Tekt1 UTSW 11 72351952 missense probably damaging 1.00
R0531:Tekt1 UTSW 11 72345594 missense possibly damaging 0.67
R1190:Tekt1 UTSW 11 72355213 missense probably damaging 1.00
R1908:Tekt1 UTSW 11 72351935 missense probably benign 0.41
R3784:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3785:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3787:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3831:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3832:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3833:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3916:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R3917:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R5645:Tekt1 UTSW 11 72351837 missense probably benign 0.02
R7740:Tekt1 UTSW 11 72359718 missense probably benign 0.03
Z1176:Tekt1 UTSW 11 72345698 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCACCTGAAATGAGAGCTC -3'
(R):5'- GCACTGCCTAGAGAAGCAAG -3'

Sequencing Primer
(F):5'- CACCTGAAATGAGAGCTCTGTGC -3'
(R):5'- TGTGATTATCCCTCACGC -3'
Posted On2015-03-25