Incidental Mutation 'R3783:Tmprss9'
ID272125
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Nametransmembrane protease, serine 9
SynonymsSerase-1B
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80871848-80899492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80887467 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 254 (V254F)
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105333] [ENSMUST00000219817]
Predicted Effect probably damaging
Transcript: ENSMUST00000105333
AA Change: V254F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: V254F

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219742
Predicted Effect probably damaging
Transcript: ENSMUST00000219817
AA Change: V254F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80894428 critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80892292 missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80897959 unclassified probably benign
IGL03075:Tmprss9 APN 10 80884029 missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80894865 missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80894378 missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80899323 missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80879858 missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80890445 missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80895129 missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80895100 missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80898187 unclassified probably benign
R1851:Tmprss9 UTSW 10 80892285 missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80889434 missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80887459 missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80897373 splice site probably null
R5868:Tmprss9 UTSW 10 80882746 missense probably benign 0.03
R6006:Tmprss9 UTSW 10 80883721 missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80888555 missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80898311 unclassified probably benign
R6718:Tmprss9 UTSW 10 80890364 missense probably benign
R7062:Tmprss9 UTSW 10 80895049 missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80894979 missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80882670 missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80892219 missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80893009 missense probably damaging 0.97
R7770:Tmprss9 UTSW 10 80898069 synonymous probably null
R7810:Tmprss9 UTSW 10 80897311 missense unknown
R8177:Tmprss9 UTSW 10 80895048 missense probably benign 0.00
X0062:Tmprss9 UTSW 10 80883938 splice site probably null
X0066:Tmprss9 UTSW 10 80893230 missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80888422 missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80887522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAATGCCTTGAACCTG -3'
(R):5'- ACAGATGCTAAATAAAAGCTGAGCA -3'

Sequencing Primer
(F):5'- CCTTGAACCTGGGGCCAAAAG -3'
(R):5'- CCATTCTCTATAGGAGTCAGGCATG -3'
Posted On2015-03-25