Incidental Mutation 'R3794:Pkdcc'
ID272706
Institutional Source Beutler Lab
Gene Symbol Pkdcc
Ensembl Gene ENSMUSG00000024247
Gene Nameprotein kinase domain containing, cytoplasmic
SynonymsMAd1, Vlk, Adtk1, ESTM17
MMRRC Submission 040756-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3794 (G1)
Quality Score196
Status Validated
Chromosome17
Chromosomal Location83215292-83225070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83223953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 464 (T464A)
Ref Sequence ENSEMBL: ENSMUSP00000129238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170794]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168118
Predicted Effect unknown
Transcript: ENSMUST00000170758
AA Change: T199A
Predicted Effect probably damaging
Transcript: ENSMUST00000170794
AA Change: T464A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129238
Gene: ENSMUSG00000024247
AA Change: T464A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 92 128 N/A INTRINSIC
Pfam:Pkinase 139 321 1.3e-5 PFAM
Pfam:PIP49_C 196 373 3.8e-11 PFAM
Meta Mutation Damage Score 0.2454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygous null mutants die on postnatal day P0, apparently due to ineffective respiration. They exhibit shortening of all the long bones of the fore- and hindlimbs, cleft palate, sternal dysraphia and deficient mineralization or other anomalies of multiple bones throughout the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T G X: 112,240,678 M1R probably null Het
Adcy6 C T 15: 98,598,943 V482I probably damaging Het
Adgrv1 T A 13: 81,283,367 M1L probably damaging Het
Ceacam13 A G 7: 18,013,415 *264W probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dennd5b A T 6: 149,101,217 D31E possibly damaging Het
Dip2c T C 13: 9,604,561 V706A probably damaging Het
Enpp3 T C 10: 24,831,732 probably null Het
Exoc4 T G 6: 33,475,997 V474G probably benign Het
F2rl1 A G 13: 95,513,211 Y388H unknown Het
Fasl T C 1: 161,781,737 R17G probably benign Het
Htr1a G A 13: 105,444,344 V31M possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Itih3 T C 14: 30,918,394 Y319C probably damaging Het
Kmt2d T C 15: 98,837,359 probably benign Het
Mobp A T 9: 120,167,967 K55* probably null Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrc3 T C 16: 3,947,875 I1057V probably benign Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr129 A G 17: 38,054,895 Y224H probably damaging Het
Piezo2 C T 18: 63,081,793 R1257Q probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Pon3 A G 6: 5,221,578 Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scaf8 A G 17: 3,190,249 E632G probably damaging Het
Smurf1 A G 5: 144,901,175 probably null Het
Tcrg-V5 A T 13: 19,192,524 H47L probably benign Het
Tln1 G T 4: 43,536,295 A1999D probably damaging Het
Ttn C T 2: 76,942,437 V2405I possibly damaging Het
Vps13d G A 4: 145,085,437 probably benign Het
Xrcc1 A G 7: 24,570,560 T469A probably benign Het
Zfp287 G T 11: 62,714,244 H612Q probably damaging Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Other mutations in Pkdcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Pkdcc APN 17 83220119 missense probably damaging 1.00
IGL02517:Pkdcc APN 17 83223866 missense probably damaging 1.00
PIT4791001:Pkdcc UTSW 17 83220148 nonsense probably null
R0180:Pkdcc UTSW 17 83221870 critical splice donor site probably null
R0321:Pkdcc UTSW 17 83222112 splice site probably benign
R0559:Pkdcc UTSW 17 83216025 missense probably benign 0.00
R0799:Pkdcc UTSW 17 83223918 missense probably damaging 1.00
R1512:Pkdcc UTSW 17 83220044 missense possibly damaging 0.88
R2484:Pkdcc UTSW 17 83222238 splice site probably benign
R2916:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R2918:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R3120:Pkdcc UTSW 17 83220037 missense probably damaging 1.00
R3795:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R4433:Pkdcc UTSW 17 83221141 missense probably benign 0.02
R4689:Pkdcc UTSW 17 83215861 missense probably damaging 1.00
R5239:Pkdcc UTSW 17 83215984 missense probably damaging 1.00
R5580:Pkdcc UTSW 17 83220082 missense probably damaging 0.96
R5654:Pkdcc UTSW 17 83215908 missense probably damaging 1.00
R5739:Pkdcc UTSW 17 83215794 missense probably benign 0.44
R6456:Pkdcc UTSW 17 83220119 missense probably damaging 1.00
R7046:Pkdcc UTSW 17 83224258 missense probably damaging 0.97
R7050:Pkdcc UTSW 17 83215644 missense possibly damaging 0.46
R8557:Pkdcc UTSW 17 83221066 missense probably benign 0.02
Z1088:Pkdcc UTSW 17 83222150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTAGAGTACCAGCGCATCC -3'
(R):5'- AAGACCAGCTTCCGACCTAG -3'

Sequencing Primer
(F):5'- ATCCCGGACAGTGCCATC -3'
(R):5'- TCTTCTTGGAGGTAAGACTACTTTC -3'
Posted On2015-03-25