Mutagenetix > Incidental Mutations

Incidental Mutation 'R3794:Enpp3'

272692

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

040756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R3794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 24831732 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]

Predicted Effect

probably null
Transcript: ENSMUST00000020169

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

silent
Transcript: ENSMUST00000217903

Predicted Effect

probably null
Transcript: ENSMUST00000218044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Predicted Effect

probably benign
Transcript: ENSMUST00000219342

Predicted Effect

probably null
Transcript: ENSMUST00000219968

Predicted Effect

probably benign
Transcript: ENSMUST00000220209

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	G	X: 112,240,678	M1R	probably null	Het
Adcy6	C	T	15: 98,598,943	V482I	probably damaging	Het
Adgrv1	T	A	13: 81,283,367	M1L	probably damaging	Het
Ceacam13	A	G	7: 18,013,415	*264W	probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dennd5b	A	T	6: 149,101,217	D31E	possibly damaging	Het
Dip2c	T	C	13: 9,604,561	V706A	probably damaging	Het
Exoc4	T	G	6: 33,475,997	V474G	probably benign	Het
F2rl1	A	G	13: 95,513,211	Y388H	unknown	Het
Fasl	T	C	1: 161,781,737	R17G	probably benign	Het
Htr1a	G	A	13: 105,444,344	V31M	possibly damaging	Het
Inpp4b	T	C	8: 82,033,216	V445A	probably damaging	Het
Itih3	T	C	14: 30,918,394	Y319C	probably damaging	Het
Kmt2d	T	C	15: 98,837,359		probably benign	Het
Mobp	A	T	9: 120,167,967	K55*	probably null	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Nlrc3	T	C	16: 3,947,875	I1057V	probably benign	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr129	A	G	17: 38,054,895	Y224H	probably damaging	Het
Piezo2	C	T	18: 63,081,793	R1257Q	probably damaging	Het
Pigv	A	G	4: 133,665,191	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,223,953	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,047	I18V	probably damaging	Het
Pon3	A	G	6: 5,221,578	Y351H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scaf8	A	G	17: 3,190,249	E632G	probably damaging	Het
Smurf1	A	G	5: 144,901,175		probably null	Het
Tcrg-V5	A	T	13: 19,192,524	H47L	probably benign	Het
Tln1	G	T	4: 43,536,295	A1999D	probably damaging	Het
Ttn	C	T	2: 76,942,437	V2405I	possibly damaging	Het
Vps13d	G	A	4: 145,085,437		probably benign	Het
Xrcc1	A	G	7: 24,570,560	T469A	probably benign	Het
Zfp287	G	T	11: 62,714,244	H612Q	probably damaging	Het
Zfp352	C	T	4: 90,225,149	H509Y	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTTCTGTGTGTCAGGGTAAAAG -3'
(R):5'- TTGCTGCTGCGTCTGATACC -3'

Sequencing Primer
(F):5'- TGTCAGGGTAAAAGAGGAAAGTCCAC -3'
(R):5'- AATTAGCATGCTGCCTGGAC -3'

Posted On

2015-03-25